ID: 949638777

View in Genome Browser
Species Human (GRCh38)
Location 3:6012487-6012509
Sequence AGTTATCTGCAAAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949638777_949638783 25 Left 949638777 3:6012487-6012509 CCTGCCATCTTTTGCAGATAACT No data
Right 949638783 3:6012535-6012557 AGCCTGTTACTGGGCTTTGGTGG No data
949638777_949638782 22 Left 949638777 3:6012487-6012509 CCTGCCATCTTTTGCAGATAACT No data
Right 949638782 3:6012532-6012554 CTCAGCCTGTTACTGGGCTTTGG No data
949638777_949638781 16 Left 949638777 3:6012487-6012509 CCTGCCATCTTTTGCAGATAACT No data
Right 949638781 3:6012526-6012548 ACAGCTCTCAGCCTGTTACTGGG No data
949638777_949638780 15 Left 949638777 3:6012487-6012509 CCTGCCATCTTTTGCAGATAACT No data
Right 949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949638777 Original CRISPR AGTTATCTGCAAAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr