ID: 949638780

View in Genome Browser
Species Human (GRCh38)
Location 3:6012525-6012547
Sequence GACAGCTCTCAGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949638776_949638780 16 Left 949638776 3:6012486-6012508 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG No data
949638778_949638780 11 Left 949638778 3:6012491-6012513 CCATCTTTTGCAGATAACTATTA No data
Right 949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG No data
949638777_949638780 15 Left 949638777 3:6012487-6012509 CCTGCCATCTTTTGCAGATAACT No data
Right 949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949638780 Original CRISPR GACAGCTCTCAGCCTGTTAC TGG Intergenic
No off target data available for this crispr