ID: 949641024

View in Genome Browser
Species Human (GRCh38)
Location 3:6036151-6036173
Sequence GCAGCCAGGAAGTTTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949641024_949641028 26 Left 949641024 3:6036151-6036173 CCCACTTTAAACTTCCTGGCTGC No data
Right 949641028 3:6036200-6036222 GCCTACTCAAGCCTCAGTAATGG 0: 357
1: 747
2: 1918
3: 1507
4: 922
949641024_949641027 -4 Left 949641024 3:6036151-6036173 CCCACTTTAAACTTCCTGGCTGC No data
Right 949641027 3:6036170-6036192 CTGCTTTGTTTACACTGTGAAGG 0: 15
1: 247
2: 607
3: 415
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949641024 Original CRISPR GCAGCCAGGAAGTTTAAAGT GGG (reversed) Intergenic
No off target data available for this crispr