ID: 949647591

View in Genome Browser
Species Human (GRCh38)
Location 3:6114658-6114680
Sequence ATCTCATATTATGCGTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949647591_949647595 27 Left 949647591 3:6114658-6114680 CCAACATACGCATAATATGAGAT No data
Right 949647595 3:6114708-6114730 CAGAAAGACTGAGGAAGTCATGG No data
949647591_949647594 18 Left 949647591 3:6114658-6114680 CCAACATACGCATAATATGAGAT No data
Right 949647594 3:6114699-6114721 AGAAAGAGGCAGAAAGACTGAGG No data
949647591_949647593 4 Left 949647591 3:6114658-6114680 CCAACATACGCATAATATGAGAT No data
Right 949647593 3:6114685-6114707 AGAAAAGGATAGAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949647591 Original CRISPR ATCTCATATTATGCGTATGT TGG (reversed) Intergenic
No off target data available for this crispr