ID: 949663047

View in Genome Browser
Species Human (GRCh38)
Location 3:6303880-6303902
Sequence TTGGTGCTGGGGCTTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949663039_949663047 11 Left 949663039 3:6303846-6303868 CCAGGTGCTTGATGGCCACCTGC No data
Right 949663047 3:6303880-6303902 TTGGTGCTGGGGCTTGTGTCTGG No data
949663042_949663047 -7 Left 949663042 3:6303864-6303886 CCTGCTAGATTCTGCCTTGGTGC No data
Right 949663047 3:6303880-6303902 TTGGTGCTGGGGCTTGTGTCTGG No data
949663040_949663047 -4 Left 949663040 3:6303861-6303883 CCACCTGCTAGATTCTGCCTTGG No data
Right 949663047 3:6303880-6303902 TTGGTGCTGGGGCTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949663047 Original CRISPR TTGGTGCTGGGGCTTGTGTC TGG Intergenic
No off target data available for this crispr