ID: 949667440

View in Genome Browser
Species Human (GRCh38)
Location 3:6356502-6356524
Sequence CCCGCAGCTTCTCCTCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667440_949667452 26 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667452 3:6356551-6356573 GTGTTTGGGAATGGAGAGCTGGG No data
949667440_949667454 28 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667454 3:6356553-6356575 GTTTGGGAATGGAGAGCTGGGGG No data
949667440_949667451 25 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667451 3:6356550-6356572 TGTGTTTGGGAATGGAGAGCTGG No data
949667440_949667447 1 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667447 3:6356526-6356548 AGAGGGAAGGACAGTGTGGCAGG No data
949667440_949667453 27 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667453 3:6356552-6356574 TGTTTGGGAATGGAGAGCTGGGG No data
949667440_949667448 11 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667448 3:6356536-6356558 ACAGTGTGGCAGGCTGTGTTTGG No data
949667440_949667455 29 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667455 3:6356554-6356576 TTTGGGAATGGAGAGCTGGGGGG No data
949667440_949667449 12 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667449 3:6356537-6356559 CAGTGTGGCAGGCTGTGTTTGGG No data
949667440_949667446 -3 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667446 3:6356522-6356544 GGGCAGAGGGAAGGACAGTGTGG No data
949667440_949667450 17 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667450 3:6356542-6356564 TGGCAGGCTGTGTTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949667440 Original CRISPR CCCGCAGCTTCTCCTCGGAG TGG (reversed) Intergenic