ID: 949667442

View in Genome Browser
Species Human (GRCh38)
Location 3:6356507-6356529
Sequence CTCTGCCCGCAGCTTCTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667442_949667451 20 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667451 3:6356550-6356572 TGTGTTTGGGAATGGAGAGCTGG No data
949667442_949667448 6 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667448 3:6356536-6356558 ACAGTGTGGCAGGCTGTGTTTGG No data
949667442_949667454 23 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667454 3:6356553-6356575 GTTTGGGAATGGAGAGCTGGGGG No data
949667442_949667447 -4 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667447 3:6356526-6356548 AGAGGGAAGGACAGTGTGGCAGG No data
949667442_949667453 22 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667453 3:6356552-6356574 TGTTTGGGAATGGAGAGCTGGGG No data
949667442_949667449 7 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667449 3:6356537-6356559 CAGTGTGGCAGGCTGTGTTTGGG No data
949667442_949667450 12 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667450 3:6356542-6356564 TGGCAGGCTGTGTTTGGGAATGG No data
949667442_949667446 -8 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667446 3:6356522-6356544 GGGCAGAGGGAAGGACAGTGTGG No data
949667442_949667452 21 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667452 3:6356551-6356573 GTGTTTGGGAATGGAGAGCTGGG No data
949667442_949667455 24 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667455 3:6356554-6356576 TTTGGGAATGGAGAGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949667442 Original CRISPR CTCTGCCCGCAGCTTCTCCT CGG (reversed) Intergenic