ID: 949667446

View in Genome Browser
Species Human (GRCh38)
Location 3:6356522-6356544
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667442_949667446 -8 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667446 3:6356522-6356544 GGGCAGAGGGAAGGACAGTGTGG No data
949667437_949667446 20 Left 949667437 3:6356479-6356501 CCGTTACTAAGCTGAGGGTTATG No data
Right 949667446 3:6356522-6356544 GGGCAGAGGGAAGGACAGTGTGG No data
949667440_949667446 -3 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667446 3:6356522-6356544 GGGCAGAGGGAAGGACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type