ID: 949667447

View in Genome Browser
Species Human (GRCh38)
Location 3:6356526-6356548
Sequence AGAGGGAAGGACAGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667442_949667447 -4 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667447 3:6356526-6356548 AGAGGGAAGGACAGTGTGGCAGG No data
949667440_949667447 1 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667447 3:6356526-6356548 AGAGGGAAGGACAGTGTGGCAGG No data
949667437_949667447 24 Left 949667437 3:6356479-6356501 CCGTTACTAAGCTGAGGGTTATG No data
Right 949667447 3:6356526-6356548 AGAGGGAAGGACAGTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949667447 Original CRISPR AGAGGGAAGGACAGTGTGGC AGG Intergenic
No off target data available for this crispr