ID: 949667451

View in Genome Browser
Species Human (GRCh38)
Location 3:6356550-6356572
Sequence TGTGTTTGGGAATGGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667442_949667451 20 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667451 3:6356550-6356572 TGTGTTTGGGAATGGAGAGCTGG No data
949667440_949667451 25 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667451 3:6356550-6356572 TGTGTTTGGGAATGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949667451 Original CRISPR TGTGTTTGGGAATGGAGAGC TGG Intergenic
No off target data available for this crispr