ID: 949667452

View in Genome Browser
Species Human (GRCh38)
Location 3:6356551-6356573
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667442_949667452 21 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667452 3:6356551-6356573 GTGTTTGGGAATGGAGAGCTGGG No data
949667440_949667452 26 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667452 3:6356551-6356573 GTGTTTGGGAATGGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type