ID: 949667454

View in Genome Browser
Species Human (GRCh38)
Location 3:6356553-6356575
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949667442_949667454 23 Left 949667442 3:6356507-6356529 CCGAGGAGAAGCTGCGGGCAGAG No data
Right 949667454 3:6356553-6356575 GTTTGGGAATGGAGAGCTGGGGG No data
949667440_949667454 28 Left 949667440 3:6356502-6356524 CCACTCCGAGGAGAAGCTGCGGG No data
Right 949667454 3:6356553-6356575 GTTTGGGAATGGAGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type