ID: 949670933

View in Genome Browser
Species Human (GRCh38)
Location 3:6398561-6398583
Sequence TTTCTTGCCCCCCAGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 45, 1: 26, 2: 48, 3: 193, 4: 567}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670933_949670943 27 Left 949670933 3:6398561-6398583 CCACCTTTCTGGGGGGCAAGAAA 0: 45
1: 26
2: 48
3: 193
4: 567
Right 949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG No data
949670933_949670944 28 Left 949670933 3:6398561-6398583 CCACCTTTCTGGGGGGCAAGAAA 0: 45
1: 26
2: 48
3: 193
4: 567
Right 949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG No data
949670933_949670941 8 Left 949670933 3:6398561-6398583 CCACCTTTCTGGGGGGCAAGAAA 0: 45
1: 26
2: 48
3: 193
4: 567
Right 949670941 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
949670933_949670945 29 Left 949670933 3:6398561-6398583 CCACCTTTCTGGGGGGCAAGAAA 0: 45
1: 26
2: 48
3: 193
4: 567
Right 949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670933 Original CRISPR TTTCTTGCCCCCCAGAAAGG TGG (reversed) Intergenic
900097792 1:947316-947338 GTGAGTGCCCCCCAGAAAGGGGG + Intronic
900840593 1:5045885-5045907 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
901361501 1:8704818-8704840 GTCTTTGCCCCCCTGAAAGGTGG + Intronic
902235309 1:15053584-15053606 TTTCTTGCCCCACAGGAATGTGG + Intronic
903426914 1:23260545-23260567 TTTTTTTCCCCCAAGAAATGAGG + Intergenic
903451566 1:23457020-23457042 TTCCATGCCCCACTGAAAGGGGG - Intronic
904941500 1:34166986-34167008 GTTCTTGGCACCCAGCAAGGCGG - Intronic
905060731 1:35137073-35137095 GTTCTTGCCTCCCAGAAAAGTGG + Intergenic
905060745 1:35137129-35137151 GTCCTTGCCCCCCAGAAAAGCGG + Intergenic
905499618 1:38426255-38426277 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
906080758 1:43086666-43086688 GTTCTTACCCTCCAGAAAAGGGG - Intergenic
906744738 1:48213805-48213827 ATTCTTGCCCCCTAGAAAAGCGG + Intergenic
907236856 1:53057439-53057461 TTTCTGGCCCCTAAGAAATGTGG + Intergenic
907292437 1:53425342-53425364 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
907292463 1:53425442-53425464 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
907503727 1:54902402-54902424 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
907503789 1:54902653-54902675 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
908832219 1:68190732-68190754 ATTCTTGACCCACAGAAATGAGG + Intronic
909035282 1:70589381-70589403 GTTCTTGTCCCCTAGAAAAGTGG - Intergenic
909729222 1:78873075-78873097 GTGCTTGCCCCCCCGAAAAGTGG - Intergenic
909776860 1:79493101-79493123 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
909788421 1:79643286-79643308 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
909978632 1:82072134-82072156 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
910002918 1:82359488-82359510 ATGCTTGCCCCCCAGGAAAGTGG + Intergenic
910049217 1:82956495-82956517 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
910484359 1:87696501-87696523 TTTATTTCCCCCCAGAATAGGGG - Intergenic
911048107 1:93645262-93645284 TTTTTTTCCCCCTTGAAAGGAGG - Intronic
911148228 1:94571800-94571822 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
911510779 1:98805816-98805838 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
911510795 1:98805875-98805897 GTTCTTGCCCTCCAGAAAAGTGG + Intergenic
911759952 1:101602611-101602633 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
912296265 1:108473907-108473929 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
912815488 1:112825073-112825095 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
913260922 1:116997341-116997363 TCTTTTTCCCCCCAGAAAAGAGG + Intergenic
913375262 1:118144281-118144303 TTTGGTGCCCTCCAGAAATGTGG + Intronic
915266227 1:154719908-154719930 TTTCCTGCCAGCCAGAGAGGTGG - Intronic
916272754 1:162961551-162961573 TTGCTTGCCCCCCATAAAAAAGG + Intergenic
916328701 1:163592196-163592218 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
916852812 1:168720752-168720774 TTTCTTTCCCGCCCCAAAGGTGG + Intronic
916931094 1:169578802-169578824 TTCCTGGCCCCCCATGAAGGTGG + Intronic
918346923 1:183614716-183614738 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
918346952 1:183614816-183614838 GTTCTTGCCCTCCCGAAAAGTGG - Intergenic
918567875 1:185953021-185953043 GTTTTTGCCCCCTAGAAAAGCGG + Intronic
918714593 1:187770158-187770180 GTTCTTGCCCCCTAGGAAAGTGG + Intergenic
919476236 1:198035962-198035984 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
920829208 1:209449962-209449984 GTTCTTGCCCCCCAGGAAAGTGG - Intergenic
920901697 1:210115362-210115384 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
921212225 1:212910538-212910560 GTTCTTGCCCCCTAGGAAAGTGG - Intergenic
921509106 1:216009171-216009193 GTTCTTACCCTCCAGAAAAGTGG - Intronic
921519937 1:216146576-216146598 TTTCTTGCCCCCTAGGAAAGCGG - Intronic
922048232 1:221967005-221967027 GTTCTTGCCCCTTAGAAAAGTGG - Intergenic
922154268 1:223029105-223029127 CTTCTTGCCCCCTAGGAAAGCGG + Intergenic
922363720 1:224845049-224845071 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
922363736 1:224845108-224845130 GTGCTTGCCCTCCAGAAAAGTGG + Intergenic
922363757 1:224845202-224845224 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
922409198 1:225354109-225354131 TTTATTCTCCCCCAGAAAGGAGG + Intronic
922906186 1:229175354-229175376 GTTCTTGCCCCATAGAAAAGCGG - Intergenic
922934661 1:229413567-229413589 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
923074995 1:230602170-230602192 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
923432091 1:233932516-233932538 TTTCTGCCACCCCAGAAAGAAGG - Intronic
923962565 1:239102203-239102225 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
924180431 1:241434876-241434898 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
924180494 1:241435143-241435165 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
924826901 1:247549241-247549263 TCTCTTTCTCCCAAGAAAGGCGG - Intronic
1063232672 10:4081124-4081146 TTTCTTTCCAGTCAGAAAGGTGG - Intergenic
1063362907 10:5471764-5471786 GTTCTTGGCCCCTAGAAAAGCGG - Intergenic
1064887153 10:20123704-20123726 GTTCTTACCCTCCAGAAAAGTGG + Intronic
1065082960 10:22145399-22145421 TTTCTTTCTCACCAGAGAGGAGG - Intergenic
1065437398 10:25717279-25717301 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1065437410 10:25717337-25717359 GTTCTTGCCCTCTAGAAAAGGGG - Intergenic
1065443393 10:25773888-25773910 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1067360163 10:45572081-45572103 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1067360182 10:45572139-45572161 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1067360201 10:45572197-45572219 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1067360217 10:45572261-45572283 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1068179844 10:53503712-53503734 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1070128076 10:73637919-73637941 TTCTTTGCCTCCCTGAAAGGTGG - Exonic
1070474742 10:76819617-76819639 TTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1071821522 10:89285686-89285708 GTCCTTGCCCCCCAGGAAAGTGG - Intronic
1071821536 10:89285723-89285745 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1071916020 10:90296052-90296074 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1071960875 10:90808247-90808269 TTTCTTGCCCCCCAGAAAGGTGG - Intronic
1071960902 10:90808367-90808389 TTTCTTGCCCCCCAGAAAGGCGG - Intronic
1071960961 10:90808618-90808640 GTTCTTACCCTCCAGAAAAGTGG - Intronic
1072011530 10:91306440-91306462 GTTCTTGCCCCCCAGAAAAGAGG + Intergenic
1073124963 10:101143351-101143373 TTTCTTGACCCAGAGAAGGGAGG - Intergenic
1073683356 10:105728466-105728488 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1073709655 10:106022167-106022189 GTTCTTATCCCCCAGAAAAGCGG + Intergenic
1074018818 10:109563318-109563340 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
1074018844 10:109563436-109563458 GTTCTTGCCTCCCAGAAAAGCGG - Intergenic
1074740613 10:116481815-116481837 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1075248515 10:120845920-120845942 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1076229792 10:128810703-128810725 TATCTGGCCCTTCAGAAAGGTGG - Intergenic
1077612020 11:3649076-3649098 GTTCTTACCCTCCAGAAAAGCGG - Intronic
1077679314 11:4224277-4224299 GTTCTTGCCCTCCAGAAAAGCGG + Intergenic
1077679329 11:4224335-4224357 CTTCTTGCCCTACAGAAAAGCGG + Intergenic
1077679343 11:4224393-4224415 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1077688748 11:4320919-4320941 GTTCTTGCCCTCCAGAAAAGCGG + Intergenic
1077688764 11:4320977-4320999 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1077851036 11:6074773-6074795 GTTCTTGCCCCATAGAAAAGTGG + Intergenic
1078046337 11:7916931-7916953 GTTCTTGCCCCATAGAAAAGTGG + Intergenic
1079447277 11:20568838-20568860 TTTCTTGCCCCCTAGGAAAGTGG - Intergenic
1079727238 11:23891730-23891752 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1079727303 11:23891981-23892003 TTTCTGGCCCCCAAGAAAGGCGG + Intergenic
1081159488 11:39735167-39735189 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1081356622 11:42121622-42121644 TTTCTTGCCCCCTAGGAAAGTGG - Intergenic
1083534159 11:63453540-63453562 GTTCTTGCCCCCCATAAAAGTGG - Intergenic
1083534175 11:63453600-63453622 GTTATTGTCCCCCAGAAAAGTGG - Intergenic
1084232082 11:67760607-67760629 TTTCTTGTCCCCCAGAAAGGTGG - Intergenic
1084232138 11:67760853-67760875 GTTCTTCCCCTCCAGAAAAGTGG - Intergenic
1084355338 11:68634657-68634679 TTTCTTGCCCCGCAGAAAGGTGG - Intergenic
1084437399 11:69152018-69152040 TTTCTTTGTCCCCAGAGAGGGGG - Intergenic
1084613489 11:70219090-70219112 TTTCTTGCCTTACAGAAAGGTGG + Intergenic
1084613515 11:70219211-70219233 TTTCTTGCCCTCCAGAAAGGTGG + Intergenic
1084739223 11:71128174-71128196 TTTCCTGTCTCCCAGGAAGGTGG + Intronic
1085282406 11:75339935-75339957 TTTCTTGCCACCCAGAACCTGGG + Intronic
1085987791 11:81807088-81807110 GTTCTTGCCTCCCAGAAAGGCGG - Intergenic
1086132937 11:83420073-83420095 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1086550037 11:88044323-88044345 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1087196727 11:95310600-95310622 GTTCTTGCCCCCTAGGAAAGTGG - Intergenic
1087839753 11:102908895-102908917 ATTCTTGCCCCCTAGAAAAGTGG + Intergenic
1089348911 11:117810330-117810352 GTTCTTGCCCCCTAGAAAAGCGG - Intronic
1089472242 11:118730698-118730720 GTTCTTACCCTCCAGAAAGCGGG + Intergenic
1089472296 11:118730906-118730928 TTTCTTGCACCCCAGAAAGGTGG + Intergenic
1089953089 11:122547731-122547753 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1089987206 11:122825475-122825497 TTTCTTGCCCTCCAGAAAGGCGG - Intergenic
1090309676 11:125724142-125724164 ACTCTTGCCACCTAGAAAGGAGG + Intergenic
1090850782 11:130568984-130569006 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1090872137 11:130758128-130758150 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1090927167 11:131259264-131259286 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1090927184 11:131259324-131259346 GTTCTTGCCTCCCAGAAAAGTGG + Intergenic
1091100697 11:132870269-132870291 TTTATTGCCCTCGAGAAAAGTGG - Intronic
1091183503 11:133627954-133627976 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1091886321 12:4019567-4019589 CTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1092416333 12:8293091-8293113 ATTCTTGCCTTCCAGAAAAGTGG + Intergenic
1092474250 12:8805793-8805815 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
1092592910 12:9967621-9967643 GTTCTTGCCCCCAAGAAGAGCGG + Intronic
1092592927 12:9967681-9967703 GTTCTTGCCCCCCAGAAAAGCGG + Intronic
1092723925 12:11466962-11466984 GTTCTTGCCCCATAGAAAAGTGG + Intronic
1092739478 12:11614230-11614252 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1092789496 12:12059300-12059322 TTTCTTGCACCCCAGAAAGGTGG - Intronic
1092925040 12:13264636-13264658 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1093071353 12:14709552-14709574 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1093268169 12:17026226-17026248 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1093322147 12:17724825-17724847 GTTCTTACCCTCCAGAAAAGAGG + Intergenic
1093578547 12:20764009-20764031 GTTCTTGCCCTCTAGAAAAGTGG - Intergenic
1093584685 12:20821578-20821600 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
1093813010 12:23510583-23510605 GTTTTTGCCCTCCAGAAAAGCGG + Intergenic
1093950853 12:25164083-25164105 TTTCTTGCCCTCCAGAAAAGCGG - Intronic
1093950868 12:25164142-25164164 ATTCTTGCCTCCCAGAAAAGCGG - Intronic
1093950882 12:25164198-25164220 TTTCTTGCCCCGCAGAAAAGTGG - Intronic
1093950895 12:25164258-25164280 ATTCTTGCCCTCTAGAAAAGTGG - Intronic
1093950909 12:25164316-25164338 GTTCTTGCGCCCCAGAAAAGTGG - Intronic
1094316239 12:29139636-29139658 GTTCTTGCCCCCCACAAAAGTGG + Intergenic
1094316296 12:29139874-29139896 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1094400457 12:30056951-30056973 GTTCTTGCCCCCCAGAAAAGTGG - Intergenic
1094400472 12:30057012-30057034 GTTCTTGCCCACCAGAAAAGTGG - Intergenic
1094400504 12:30057132-30057154 TTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1094825605 12:34266814-34266836 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1097417207 12:59327750-59327772 GTTCTTGTCCTCCAGAAAAGCGG + Intergenic
1097417239 12:59327893-59327915 CTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1097693951 12:62759665-62759687 GTGCTTGCCCCCCAGAAAAGCGG - Intronic
1097693965 12:62759723-62759745 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1097693989 12:62759797-62759819 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1097694001 12:62759834-62759856 ATGCTTGCCCCCCAGGAAAGTGG - Intronic
1097694012 12:62759871-62759893 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1098000345 12:65935054-65935076 TTTCTTGCCCCCCAGTAGAAGGG + Intronic
1098173821 12:67771297-67771319 GTTCTTGCCCCATAGAAAAGCGG + Intergenic
1098402057 12:70086445-70086467 TTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1098486289 12:71025750-71025772 GGTCATGCACCCCAGAAAGGAGG - Intergenic
1098653991 12:73006539-73006561 GTTCTTGCCCTCCAGAGAAGCGG + Intergenic
1098654019 12:73006658-73006680 GTTCTTGCCCCACAGAAAAGTGG + Intergenic
1098654034 12:73006717-73006739 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1098654065 12:73006833-73006855 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1099188513 12:79540874-79540896 ATTCTTGCCCCGTAGAAAAGCGG - Intergenic
1099292251 12:80787620-80787642 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1099292322 12:80787953-80787975 TTTCTTGCCCCCCAGAAAGGAGG + Intergenic
1099762377 12:86939716-86939738 GTTCTTGCCCCATAGAAAAGCGG - Intergenic
1100801958 12:98241450-98241472 TTTCTTGCCCACCTGAACAGTGG + Intergenic
1100940137 12:99716344-99716366 GTTCTTACCCTCCAGAAAAGTGG - Intronic
1101278622 12:103227508-103227530 GTTCTTGCCCCATAGAAAAGTGG + Intergenic
1101422268 12:104559418-104559440 TGTCTTCCCCACCAGAATGGAGG - Intronic
1102331944 12:112041141-112041163 TTTTTTCCCCCCAAGAAATGAGG - Intronic
1106943255 13:34799714-34799736 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1107026412 13:35806273-35806295 TATCTTGCCACCCAGAATTGGGG - Intronic
1107265266 13:38546055-38546077 TGTCTGGGCCCCCAGCAAGGTGG - Intergenic
1107411459 13:40162314-40162336 GTTCATGCCCACCAGAGAGGTGG + Intergenic
1107540364 13:41383937-41383959 TTTCTTACCCCCTAAAAAGAAGG - Intergenic
1107683332 13:42872094-42872116 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1108277798 13:48828731-48828753 GTTGTTGCCTCCCAGAAAGAAGG + Intergenic
1108512798 13:51170905-51170927 CTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1108625921 13:52228763-52228785 TTTCTTGACCCCCAGCACTGTGG + Intergenic
1108953105 13:56116961-56116983 GTTCTTACCTCCCAGAAAAGTGG + Intergenic
1108953159 13:56117211-56117233 GTTCTTGCCCCGTAGAAAAGCGG + Intergenic
1109343374 13:61089325-61089347 GTTCTTTCCCCCTAGAAAAGTGG - Intergenic
1109343419 13:61089509-61089531 GTTCTTCCCCTCCAGAAAAGCGG - Intergenic
1109499134 13:63214293-63214315 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1109625028 13:64963008-64963030 TTTCTTGGCCTCCAGCAAGGAGG - Intergenic
1109709847 13:66145995-66146017 GTTCTTGCCCCCTAGGAAAGTGG + Intergenic
1109716962 13:66231164-66231186 GTTCTTGCCCCGTAGAAAAGTGG + Intergenic
1109975728 13:69829104-69829126 TTTCTTGGCCTCCAGCCAGGAGG - Intronic
1110634336 13:77748526-77748548 TTTGTTGCACCTCAGAAAAGTGG + Intronic
1110650679 13:77938235-77938257 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1110650726 13:77938435-77938457 GTTCTTGTCCCCTAGAAAAGTGG + Intergenic
1110650741 13:77938495-77938517 GTTCTTACCCCCCAGAAAAGTGG + Intergenic
1110765309 13:79275303-79275325 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1110845126 13:80184542-80184564 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1110978314 13:81867313-81867335 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1111041665 13:82757112-82757134 TTCATTGTCCCCCAGCAAGGAGG - Intergenic
1111126200 13:83912809-83912831 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1111301804 13:86359203-86359225 GTTCTTGCCCCGTAGAAAAGTGG - Intergenic
1111362308 13:87191093-87191115 GTTCTTGTCCCCTAGAAAAGCGG + Intergenic
1111459049 13:88517556-88517578 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1111607682 13:90562000-90562022 TTTCTTGCCTCACAAAAAAGTGG + Intergenic
1111630278 13:90840578-90840600 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1111631900 13:90853294-90853316 ATTCTTGCCCCCTAGAAAAGCGG + Intergenic
1112807465 13:103178986-103179008 TTTCTTGCCCCCTACAACGAAGG - Intergenic
1113324119 13:109266292-109266314 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1113324159 13:109266435-109266457 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1114243187 14:20888179-20888201 TCTCTTGAACCTCAGAAAGGTGG - Intergenic
1114245537 14:20909987-20910009 TCTCTTGAACCTCAGAAAGGTGG - Intergenic
1114524117 14:23357483-23357505 TTTCGTGCCCCACAGCAAGAGGG - Exonic
1115240781 14:31249946-31249968 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1115904584 14:38191670-38191692 GTTCTTGCCCCGTAGAAAAGCGG - Intergenic
1115906148 14:38205409-38205431 TTTCTGGGCCACCAGGAAGGTGG - Intergenic
1116573284 14:46545060-46545082 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1116952735 14:50894261-50894283 TTTTTTGCCCCCTAGGAAAGCGG - Intronic
1118937467 14:70300733-70300755 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1119022180 14:71125138-71125160 TTTCTTGCCCCCCAGAAAGGCGG - Intergenic
1119022211 14:71125255-71125277 GTTTTTTCCTCCCAGAAAGGCGG - Intergenic
1119316986 14:73704434-73704456 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1119317039 14:73704661-73704683 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1120251554 14:82065630-82065652 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1120438210 14:84504739-84504761 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1120539726 14:85737536-85737558 GTTCTTGCCTCCCAGAAAAGTGG + Intergenic
1120660117 14:87239566-87239588 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1122040797 14:98986210-98986232 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1122176026 14:99919833-99919855 TGTCCTGCCCCCCAGAAATGTGG - Intronic
1122381512 14:101310258-101310280 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1123874030 15:24605999-24606021 TATCTTGTCCCCCACAAAAGGGG - Intergenic
1125045574 15:35239776-35239798 GTTCTTGCCCCCTAGGAAAGCGG - Intronic
1125131747 15:36290519-36290541 GTTCTTGCCCCGTAGAAAAGCGG + Intergenic
1125848914 15:42885635-42885657 GTACTTGCCCCCCAGAAAGGCGG - Intronic
1125848931 15:42885694-42885716 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1126346656 15:47702183-47702205 TTCCTTGCCCCTCAGAAAAATGG + Intronic
1126530363 15:49703865-49703887 ATTCTTGACCCCTAGAAAAGTGG + Intergenic
1126843588 15:52739760-52739782 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1126912576 15:53431455-53431477 GTTCTTGCTCCCTAGAAAAGCGG + Intergenic
1127546143 15:59995615-59995637 TTTTTTTCCCCCCAAAAAGAAGG - Intergenic
1129225921 15:74170437-74170459 TTTCTCTACCTCCAGAAAGGAGG + Intergenic
1129720006 15:77872773-77872795 TGTCTTGCCCCCTAGAGAGAAGG + Intergenic
1129766786 15:78174634-78174656 CTTCTTGGCTCCCAGAAAGGGGG - Intronic
1130144369 15:81262060-81262082 TGTCCTGCCCCCCCGAAAAGAGG + Intronic
1131447466 15:92512232-92512254 GTTCTTGCCCCCCAGAAAAGTGG - Intergenic
1131447495 15:92512350-92512372 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1131683986 15:94751747-94751769 ATTCTTGCCCTCTAGAAAAGCGG - Intergenic
1131882723 15:96876616-96876638 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1132340198 15:101073461-101073483 TTTCTTGCCCCCCAGAAAGGCGG - Intronic
1133397756 16:5461981-5462003 CTGGTTGCCCACCAGAAAGGTGG + Intergenic
1133651176 16:7815607-7815629 TTTCTTGCTCCCCAGAAAGGTGG - Intergenic
1133766879 16:8844346-8844368 GTTCTTACCCTCCAGAAAAGCGG + Intronic
1133869816 16:9676213-9676235 GTTCTTGCCCCGTAGAAAAGCGG + Intronic
1133937943 16:10284114-10284136 GTGCTTGCCCCCCAGGAAAGCGG - Intergenic
1134342365 16:13357199-13357221 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1134831348 16:17326145-17326167 GTTCTTGCCACCAAAAAAGGGGG - Intronic
1139039392 16:62983695-62983717 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1139039410 16:62983753-62983775 GTTCTTGTCCCCTAGAAAAGCGG + Intergenic
1139209073 16:65058404-65058426 TTTCTAGACCACCAGAAAAGTGG - Intronic
1139943220 16:70621078-70621100 GTTCTTGCCCCCTAGGAAAGCGG + Intronic
1139943874 16:70625307-70625329 GTTCTTACCCTCCAGAAAAGTGG + Intronic
1139943904 16:70625408-70625430 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
1140349433 16:74247978-74248000 TTTCTTCACCCTCAGAAAAGTGG - Intergenic
1140779968 16:78286008-78286030 TTTTTGGACCCCCAAAAAGGTGG - Intronic
1141311557 16:82918151-82918173 TTTCTTTGACCACAGAAAGGAGG - Intronic
1144104430 17:11972771-11972793 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1145995748 17:29103855-29103877 TGTCTTGCTCCCCAGCAAGACGG - Intronic
1146705749 17:34999533-34999555 TTTCTGTCTCCCCAGAAAGAAGG + Intronic
1147460169 17:40563286-40563308 TTTCTTGCCTGCCAGAAACTTGG - Intronic
1147572721 17:41581255-41581277 TTTCTAGCCCCCCAAAGAGAAGG + Intergenic
1147805902 17:43131454-43131476 AATCTTGCTCCCCAGAAGGGTGG + Intergenic
1149412702 17:56425288-56425310 TTTCCTCCCCCTCACAAAGGTGG + Intronic
1151622295 17:75253627-75253649 GTTCTTGCCCCCTAGAAAAGCGG - Intronic
1151839917 17:76610479-76610501 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1151839935 17:76610537-76610559 GTTCTTGCCCCATAGAAAAGCGG + Intergenic
1152043194 17:77918372-77918394 ATTCTAGCCCTGCAGAAAGGAGG - Intergenic
1155616956 18:27733216-27733238 TTTTTTCCCCCCCTCAAAGGGGG - Intergenic
1155892867 18:31288839-31288861 GTTCTTGACCCCCAGGAAAGTGG - Intergenic
1155941326 18:31804694-31804716 TTTCTTGCCCCCCAGAAAGGCGG - Intergenic
1155941384 18:31804945-31804967 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1156237180 18:35216870-35216892 GTTCTTGCCCCTCAGAAAAGCGG - Intergenic
1156237196 18:35216929-35216951 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1156302065 18:35844960-35844982 GTTCTTGCCCCCCAGAAAAATGG - Intergenic
1156915655 18:42462689-42462711 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1156924214 18:42557045-42557067 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1157161688 18:45319294-45319316 TGCCTTTCCCTCCAGAAAGGAGG + Intronic
1158328607 18:56337395-56337417 TTCCTTCCCCCACAGAAAGGGGG + Intergenic
1159164309 18:64682803-64682825 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1159289146 18:66394044-66394066 TTTATTTCCCCCTAGAATGGAGG - Intergenic
1159793325 18:72811552-72811574 TTTCTGGTCTCCCAGAGAGGTGG - Intronic
1159834856 18:73325684-73325706 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1160443897 18:78912891-78912913 TTTCTTGGGCCCCAGACTGGAGG - Intergenic
1161661529 19:5549540-5549562 TTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1162242359 19:9365418-9365440 GTTCTTGCACCCCAGAAAAGTGG + Intronic
1162242371 19:9365476-9365498 GTTCTTGACCCCCAGAAAAGCGG + Intronic
1162445444 19:10719608-10719630 TTTCTTGTCTCCCAGATGGGCGG + Intronic
1163487080 19:17594385-17594407 ATTCTTGCCCCTTAGAAAAGCGG - Intergenic
1163900488 19:20095726-20095748 GTTCTTGCCCCCTAGAAAAGTGG + Intronic
1164152780 19:22569277-22569299 CTTCTTGCCCCCTAGGAAAGTGG - Intergenic
1164459387 19:28434413-28434435 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1165082105 19:33313408-33313430 TATTTTTCCCCCCAGAAAAGTGG - Intergenic
1165110198 19:33497889-33497911 TCCCTTTCCCCTCAGAAAGGAGG - Intronic
1165497175 19:36159978-36160000 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1165510487 19:36264067-36264089 ATTCTTGCCACCTAGAAAAGTGG + Intergenic
1166499141 19:43328234-43328256 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1166643519 19:44514025-44514047 TTTCTTTCCTCCCAGAATAGAGG + Intronic
1166927334 19:46277952-46277974 GTTCTTGCCCCCCAAAAAAGTGG + Intergenic
1167046783 19:47054372-47054394 GTTCTTGACCCCTAGAAAAGCGG + Intergenic
1167099244 19:47393848-47393870 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1167247362 19:48381785-48381807 TCTGTTGCCACCCAGAAATGAGG + Intergenic
1167805703 19:51782827-51782849 GTGCTTTCCCCCCAGAGAGGTGG + Intronic
1168051392 19:53832316-53832338 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1168153870 19:54462759-54462781 TTCCTTGCCCCCCAGCAATGTGG + Exonic
1168212313 19:54899596-54899618 ATTCTTGCCCCCTAGAAAAGCGG + Intergenic
1168228186 19:55011484-55011506 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
1168247965 19:55123684-55123706 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
925829025 2:7877387-7877409 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
926407615 2:12570944-12570966 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
926464244 2:13168513-13168535 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
926464276 2:13168655-13168677 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
926815741 2:16796616-16796638 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
927130235 2:20052217-20052239 TTTCTTCGCCCCCACCAAGGAGG - Intergenic
927134000 2:20083474-20083496 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
928778089 2:34790689-34790711 CTTATTGCCCCCTAGAAAAGTGG - Intergenic
928778118 2:34790808-34790830 ATTCTTGCCCCCCAGAAAAGCGG - Intergenic
928778135 2:34790869-34790891 GTTCTTGCCCTCCAGAAAAGTGG - Intergenic
928779899 2:34805712-34805734 CTTCTTGCCCCTTAGAAAAGTGG + Intergenic
928857006 2:35814252-35814274 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
928928368 2:36600112-36600134 GTTCTTGCCACCTAGAAAAGCGG - Intronic
929076906 2:38085583-38085605 TTTCTTGCCCCCCAGAAAGGAGG + Intronic
929444262 2:41990556-41990578 TTTCCTGCACTCCAGAAAAGGGG + Intergenic
929793232 2:45038969-45038991 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
929793277 2:45039154-45039176 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
930047579 2:47186689-47186711 TTCTCTGCCTCCCAGAAAGGCGG - Intergenic
930616904 2:53603025-53603047 TCTCTTGCCCACAGGAAAGGTGG + Intronic
930958193 2:57229925-57229947 CGTCTTGCCCCCCAGAAAAGCGG - Intergenic
930958218 2:57230041-57230063 GTTCTTGACCCCCAGAAAAGTGG - Intergenic
931026572 2:58118027-58118049 GTTCTTGCCCCCTAGAAAAGTGG + Intronic
931236752 2:60418677-60418699 TTTCTTGCCCCCTAGGAAAGCGG - Intergenic
931625577 2:64253540-64253562 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
931850235 2:66244985-66245007 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
932159638 2:69448263-69448285 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
932159654 2:69448322-69448344 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
932261797 2:70333126-70333148 TTCTATGCCCACCAGAAAGGTGG - Intergenic
932268555 2:70389083-70389105 TTTCTTGGCACCCACAATGGAGG + Intergenic
932359016 2:71089759-71089781 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
932544048 2:72688457-72688479 TTCCTTGCCCACCAGGAAGGAGG - Intronic
932854398 2:75218461-75218483 GTTCTTGCCCTCTAGAAAAGCGG + Intergenic
932974164 2:76578635-76578657 GTTCTTGCCCCGTAGAAAAGCGG + Intergenic
933079083 2:77966158-77966180 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
933163528 2:79052310-79052332 TTTTCTGCCCCCCAGAAAGGTGG - Intergenic
933179991 2:79216649-79216671 GTTCTTGCTCCCTAGAAAAGCGG + Intronic
933180006 2:79216709-79216731 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
933329705 2:80879125-80879147 GTTCTTGCCCCCTAGGAAAGTGG + Intergenic
935398242 2:102633018-102633040 TTTCTTGTAGCACAGAAAGGTGG + Intronic
936883154 2:117279792-117279814 GTTCTTGCCCCCTAGGAAAGTGG - Intergenic
936890140 2:117359823-117359845 TTTGTTGGCCCCCAGCCAGGAGG - Intergenic
939083339 2:137687649-137687671 ATTCTTGCCCCCTAGAAAAGTGG + Intergenic
939460908 2:142494461-142494483 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
940107152 2:150113629-150113651 ATTCTTGCCCCCTAGAAAAGAGG - Intergenic
940107180 2:150113749-150113771 GTTCTTGCCCTCCAGAAAAGCGG - Intergenic
940676031 2:156724896-156724918 TTTCTTGCCTGCTAGAAAGGTGG + Intergenic
941340219 2:164296903-164296925 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
941456385 2:165715170-165715192 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
941936097 2:170982378-170982400 GTTCTTGCCCCTTAGAAAAGTGG + Intergenic
942096863 2:172542663-172542685 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
942096879 2:172542722-172542744 GTTCTTGCCCGCCAGAAAAGTGG - Intergenic
942096895 2:172542782-172542804 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
942672771 2:178394255-178394277 TTTTTTTTCCCCCAGAAAAGAGG + Intronic
943061401 2:183045007-183045029 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
943421786 2:187675215-187675237 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
943449964 2:188034375-188034397 GTTCTTGTCCCCCAGAAAAGCGG - Intergenic
943461372 2:188173802-188173824 GTTCATGCCCCTCAGAAAAGCGG + Intergenic
943775372 2:191759803-191759825 TTTCTAGGCCCACAGCAAGGAGG + Intergenic
943806456 2:192131471-192131493 GTTCTTGCCCCCTAGAAAAGTGG - Intronic
943834940 2:192507002-192507024 TTTCTTGCCCCCTAGAAACGCGG - Intergenic
943834993 2:192507209-192507231 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
943865195 2:192919235-192919257 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
943951456 2:194135447-194135469 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
944387232 2:199180337-199180359 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
944387285 2:199180546-199180568 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
944876279 2:203966444-203966466 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
944876346 2:203966737-203966759 TTTCTTGCCCCCCAGAAAGGCGG + Intergenic
945173293 2:207018393-207018415 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
945301695 2:208220996-208221018 TTTCTTGCCCCCCAGAAATGTGG + Intergenic
945361458 2:208900273-208900295 ATTCTTGCCTCCCAGAAAAGTGG - Intergenic
945361489 2:208900395-208900417 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
945394127 2:209300316-209300338 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
945938101 2:215923337-215923359 GTTCTTGCCCCATAGAAAAGCGG - Intergenic
946215203 2:218178599-218178621 GTTCCTGCCCCCTAGAAAAGTGG + Intergenic
946871950 2:224092471-224092493 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
946871963 2:224092508-224092530 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
946871977 2:224092566-224092588 GTGCTTGTCCCCCAGAAAAGTGG + Intergenic
946886286 2:224226252-224226274 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
946893046 2:224297565-224297587 TTTCTTGCCCCCCAGAAAGGCGG - Intergenic
947061854 2:226175852-226175874 TTTTTTTCCCCCCAGAAATTTGG - Intergenic
948193952 2:236081113-236081135 TTTCTTTCCATCCAGACAGGTGG + Intronic
948390427 2:237607708-237607730 TTTCTTGCCCCCCAGAAAGGCGG - Intergenic
1170165707 20:13359035-13359057 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1170703682 20:18726735-18726757 TGTCTGTCCCCCAAGAAAGGGGG - Intronic
1172932755 20:38597903-38597925 ATTCTTGTACCCCAGAAAAGTGG + Intergenic
1173101677 20:40094117-40094139 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1173118696 20:40270151-40270173 GTTCTTGCCCCCTAGAAACACGG - Intergenic
1173781512 20:45760614-45760636 GTTCTTACCCTCCAGAAAAGTGG - Intronic
1174197580 20:48784636-48784658 CTTCTTGACCCCCAGAAAAGGGG - Intronic
1175169218 20:57068196-57068218 CTTCTGGCATCCCAGAAAGGAGG - Intergenic
1175210689 20:57352021-57352043 TCTCTTCCCCCCCAGAATGCTGG - Intronic
1177031344 21:15984362-15984384 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1177031359 21:15984421-15984443 GTTCTTGCACCCTAGAAAAGCGG + Intergenic
1177100432 21:16893199-16893221 TTTCTTGCCCCCTAGATAAATGG - Intergenic
1177100467 21:16893340-16893362 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1177119402 21:17122638-17122660 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1178976656 21:37226542-37226564 TGTTGTGCCCCCCAGAAGGGTGG + Intronic
1179015452 21:37591566-37591588 GTTCTTGACCCCCAGAAAAGCGG + Intergenic
1179387323 21:40955793-40955815 ATTCTTGCCCCATAGAAAAGCGG - Intergenic
1179650533 21:42805593-42805615 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1180560733 22:16612428-16612450 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1182732075 22:32503756-32503778 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1184163761 22:42715271-42715293 TATCTTGACCACCAGAAATGTGG + Intronic
949162313 3:895461-895483 TTTCTTGCCCCCCAGAAAGGCGG + Intergenic
949190559 3:1244317-1244339 GTTCTTGCCTCCTAGAAAAGTGG + Intronic
949670933 3:6398561-6398583 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
949827283 3:8178189-8178211 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
950165414 3:10793615-10793637 TTTCTTCCACCCAGGAAAGGAGG - Intergenic
950926270 3:16745203-16745225 TTTCTTGCCCCCCAGAAAGGCGG - Intergenic
951298972 3:20972067-20972089 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
951762966 3:26164934-26164956 ATGCTTGCCCCCCAGGAAAGTGG + Intergenic
952343721 3:32465951-32465973 ATTCTTACCCTCCAGAAAAGTGG + Intronic
952791825 3:37206404-37206426 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
952791843 3:37206462-37206484 GTTCTTGCCCCCCAGGAAAGTGG - Intergenic
952791879 3:37206579-37206601 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
952791892 3:37206616-37206638 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
952895426 3:38075579-38075601 GTTCTTACCCTCCAGAAAAGTGG + Intronic
952895475 3:38075763-38075785 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
952896720 3:38082593-38082615 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
953077291 3:39582339-39582361 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
953077367 3:39582674-39582696 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
953825861 3:46250814-46250836 GTTCTTACCCTCCAGAAAAGCGG + Intronic
953825908 3:46250999-46251021 GTTCTTGCCCCCTAGAAAAGTGG + Intronic
954969455 3:54639156-54639178 GTTCTTGCCCCCTAGGAAAGCGG + Intronic
955253170 3:57304726-57304748 GTTCTGGCCCTCCAGAAAAGCGG - Intronic
955253197 3:57304844-57304866 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
956233671 3:67043269-67043291 GTTCTTGCCCCCCATGAAAGTGG + Intergenic
956602614 3:71038356-71038378 TTCCTTGCCCATCAGAATGGAGG + Intronic
956709057 3:72024155-72024177 GTTCTTGCCCTCCATAAAAGCGG - Intergenic
957735060 3:84192480-84192502 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
957735075 3:84192546-84192568 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
957905054 3:86543118-86543140 GTACTTGCCCCCCAGGAAAGTGG + Intergenic
959288563 3:104444747-104444769 GTTCTTGCCCCATAGAAAAGCGG + Intergenic
959485958 3:106927374-106927396 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
960310275 3:116109843-116109865 GTTCTTACCCTCCAGAAAAGCGG + Intronic
960310333 3:116110070-116110092 GTTCTTGCCCCCTAGAAAAGTGG + Intronic
961691935 3:128676307-128676329 TCTCTTGGCCCCGAGGAAGGGGG - Intronic
961711796 3:128833778-128833800 GTTCTTGCCCTCTAGAAAAGCGG + Intergenic
961724244 3:128915553-128915575 TTTCTTGGCTCCTAGAAATGGGG + Exonic
961730416 3:128960899-128960921 GTTCTTGCCCCCTAGAAAAGCGG - Intronic
961880836 3:130060194-130060216 TTTCTTGCCCCCCTGAAAGGTGG - Intergenic
962022342 3:131513679-131513701 CTGCTTGCCCCCCAGGAAAGTGG + Intergenic
963058397 3:141205891-141205913 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
963425034 3:145114061-145114083 ATTCTTGTCCCCTAGAAAAGTGG - Intergenic
963663092 3:148152469-148152491 TTTATTGCCCCCCAGAAAGGCGG - Intergenic
964067613 3:152598000-152598022 GTTCTTGCCCCTTAGAAAAGCGG - Intergenic
964067655 3:152598163-152598185 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
964125627 3:153231257-153231279 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
964176254 3:153828183-153828205 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
964176265 3:153828220-153828242 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
964176286 3:153828293-153828315 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
964176298 3:153828330-153828352 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
964176311 3:153828367-153828389 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
964300426 3:155279791-155279813 GTTCTTGCCCTCTAGAAAAGTGG + Intergenic
964300457 3:155279912-155279934 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
964906744 3:161726705-161726727 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
964941202 3:162158969-162158991 GTGCTTGCCCCCCAGTAAAGTGG + Intergenic
964941226 3:162159043-162159065 GTACTTGCCCCCCAGTAAAGTGG + Intergenic
964941258 3:162159138-162159160 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
964941282 3:162159212-162159234 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
964941298 3:162159270-162159292 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
965105391 3:164346691-164346713 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
965286910 3:166828689-166828711 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
965625042 3:170677067-170677089 GTTCTTACCCTCCAGAAAAGCGG + Intronic
965625104 3:170677317-170677339 TTTCTTGCCCCCCAGAAAGGTGG + Intronic
965626533 3:170688142-170688164 TTTCTTGCCCCCCAGAAAGGAGG + Intronic
966066683 3:175828893-175828915 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
966105265 3:176326241-176326263 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
966233000 3:177670371-177670393 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
966233018 3:177670429-177670451 GTTCTTGTCCCCTAGAAAAGCGG + Intergenic
966279023 3:178208289-178208311 GTTCTTACCCCCCAGAAAAGTGG - Intergenic
966279057 3:178208402-178208424 GTTTTTGCCCCCCAGAAAAGTGG - Intergenic
966279073 3:178208461-178208483 GTTCTTGCCCCCCAGAAAAGTGG - Intergenic
966279121 3:178208639-178208661 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
966397480 3:179517942-179517964 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
966397495 3:179518001-179518023 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
967212365 3:187180215-187180237 GTTCTTGCCCCCTAGAAAGGCGG + Intronic
967496020 3:190145510-190145532 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
967644043 3:191900157-191900179 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
967658272 3:192075619-192075641 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
967658338 3:192075912-192075934 TTTCTTGTCCCCCAGAAAGGCGG + Intergenic
968993227 4:3928548-3928570 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
969214128 4:5709150-5709172 TTTCTAGGTCCCCAGAGAGGTGG - Intronic
969654273 4:8487385-8487407 GTTCTTACCCTCCAGAAAAGCGG + Intronic
969654338 4:8487652-8487674 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
969748897 4:9095419-9095441 GTTCTTGCCTTCCAGAAAAGAGG - Intergenic
970041912 4:11807331-11807353 ATTCTTGCCCCCTAGAAAAGCGG - Intergenic
970256581 4:14175050-14175072 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
970256642 4:14175305-14175327 TTTTTTGCCCCCCAGAAAGGCGG + Intergenic
971199976 4:24502196-24502218 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
971799703 4:31272456-31272478 TTTCTTGCCTCCCATTAAGAAGG - Intergenic
974428596 4:61768995-61769017 GTTCTTGCCCCCTAGGAAAGCGG + Intronic
976285440 4:83366492-83366514 TTTGTTGCCCTCCAGGATGGAGG - Intergenic
976558407 4:86475744-86475766 GTTCTTGCCCCCTAGAAAAGCGG - Intronic
976728706 4:88241535-88241557 TCTTTTTCCCCCCAGAAATGGGG + Intergenic
976884785 4:89969534-89969556 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
977062794 4:92276600-92276622 GTTCTTGCCCCGTAGAAAAGCGG + Intergenic
977225501 4:94388007-94388029 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
977446603 4:97139169-97139191 GTGTTTGCCCCCCAGAAAAGTGG + Intergenic
977782609 4:100996351-100996373 CTGCTTGCCCCCCAGGAAAGTGG + Intergenic
977782633 4:100996425-100996447 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
977782644 4:100996462-100996484 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
977782679 4:100996593-100996615 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
979054820 4:115980338-115980360 TTTCTTGCCCCCCAGAAAGGCGG + Intergenic
979640870 4:123011975-123011997 TTGCTTGCCCCCCAGGAAAGTGG + Intronic
979640889 4:123012037-123012059 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
979640902 4:123012074-123012096 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
979640917 4:123012136-123012158 ATGCTTGCCCCCCAGGAAAGTGG + Intronic
979640949 4:123012235-123012257 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
979640978 4:123012329-123012351 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
979640996 4:123012392-123012414 ATGCTTGCCCCCCAGGAAAGTGG + Intronic
980003510 4:127516009-127516031 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
980003544 4:127516152-127516174 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
980003575 4:127516270-127516292 GTTCTTGCCCCCCAGAAAAGCGG + Intergenic
980112091 4:128645371-128645393 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
980112173 4:128645715-128645737 GTTCTTGCCTCCCAGAAAAGTGG + Intergenic
980390382 4:132137815-132137837 TTTCTAGACTCCCAGAAAGAAGG - Intergenic
980575793 4:134682429-134682451 GTTCTTGCCCTCCACAAAAGCGG + Intergenic
980575844 4:134682613-134682635 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
980903698 4:138928748-138928770 TTCTTGCCCCCCCAGAAAGGTGG - Intergenic
980903770 4:138929043-138929065 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
981040096 4:140214734-140214756 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
981524967 4:145699983-145700005 GTTCTTGCCCCATAGAAAAGAGG - Intronic
981539492 4:145833596-145833618 GTTCTTGCCCCGTAGAAAAGCGG - Intronic
981743622 4:148030097-148030119 TTTCCTCCTCCACAGAAAGGGGG - Intronic
982381393 4:154752718-154752740 TTTCTTTCCTGCCAGAAAGTTGG + Exonic
982396877 4:154923411-154923433 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
982396917 4:154923553-154923575 GTTTTTGCCCCCTAGAAAAGTGG + Intergenic
982396933 4:154923610-154923632 GTTCTTGACCCCCAGAAAAGTGG + Intergenic
982414405 4:155113242-155113264 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
982535239 4:156601282-156601304 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
983023663 4:162710107-162710129 TTTCTTCCCCCCCAGAAAGGTGG - Intergenic
983023705 4:162710269-162710291 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
983055323 4:163094272-163094294 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
983360182 4:166717157-166717179 GTTCTTGCCCCATAGAAAAGTGG - Intergenic
983447897 4:167877418-167877440 TTTCTTACCTTCCAGAAAAGTGG - Intergenic
983452119 4:167923825-167923847 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
983883950 4:172961009-172961031 GTTCTTGCCCACCAGAAAAGCGG + Intronic
983883982 4:172961126-172961148 GTTCTTGCCCACCAGAAAAGCGG + Intronic
983884016 4:172961243-172961265 GTTCTTGCCCACCAGAAAAGCGG + Intronic
984165535 4:176299457-176299479 GTTCTTGCCCCGTAGAAAAGTGG + Intergenic
984165550 4:176299516-176299538 GTTCTTGCCGCCCAGAAAAGCGG + Intergenic
984393792 4:179169511-179169533 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
984611730 4:181847534-181847556 TGTTTTTCCCCCAAGAAAGGAGG - Intergenic
984852639 4:184167591-184167613 TTTCTTTCCCCCCAAAAAAGCGG - Intronic
985375787 4:189337061-189337083 TTTCTTTCCCTCTACAAAGGTGG + Intergenic
985582161 5:703858-703880 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
985582190 5:703959-703981 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
985828743 5:2212829-2212851 TGTCCAGCCCCCCAGAGAGGAGG + Intergenic
985828778 5:2212944-2212966 TGTCCAGCCCCCCAGAGAGGAGG + Intergenic
986555718 5:9008439-9008461 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
986555769 5:9008664-9008686 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
986555895 5:9009361-9009383 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
986872021 5:12059661-12059683 TTTCTTACCCCCCAGATAGTAGG - Intergenic
986905591 5:12490904-12490926 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
987108976 5:14667026-14667048 TTTCTTTCCGCCCAGATAGTTGG + Intronic
987281878 5:16421175-16421197 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
987498313 5:18673480-18673502 GTTCTTGCCCCCTAGGAAAGTGG + Intergenic
987694251 5:21307829-21307851 TTGCATGCTCCCCAGAAAAGGGG + Intergenic
989003887 5:36788597-36788619 TTCCCTGCCCCCCACACAGGAGG - Intergenic
990555361 5:56929228-56929250 CTTCTTTCCCCCAATAAAGGAGG - Intronic
992029606 5:72708541-72708563 GTTCTAGGCTCCCAGAAAGGTGG + Intergenic
992394444 5:76358277-76358299 GTTCTTGCCCCGTAGAAAAGCGG - Intergenic
992452216 5:76885291-76885313 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
992452250 5:76885402-76885424 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
992452325 5:76885623-76885645 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
992452339 5:76885660-76885682 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
992452366 5:76885734-76885756 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
992452379 5:76885792-76885814 CTGCTTGCCCCCCAGAAAAGTGG + Intronic
992452421 5:76885985-76886007 GTGCTTGTCCCCCAGAAAAGTGG + Intronic
992452434 5:76886050-76886072 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
992452449 5:76886109-76886131 GTGCTTGCCCCCCAGAAAAGTGG + Intronic
992960608 5:81954154-81954176 TTTCTTGTCCCCCAGAAAGGCGG - Intergenic
994375990 5:99015992-99016014 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
994376008 5:99016051-99016073 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
994532718 5:100988875-100988897 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
994997864 5:107087264-107087286 TTTCCTTCACCCCAGAAATGAGG + Intergenic
995125374 5:108573362-108573384 TTTCTTGCCCTCCAGAAAAGTGG + Intergenic
995125393 5:108573425-108573447 GTTCTTGCCCTCCAGAAAAGTGG + Intergenic
995125441 5:108573606-108573628 GTTCTTGCCCTCCAGAAAAGCGG + Intergenic
995899622 5:117051291-117051313 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
996014912 5:118522238-118522260 TTTCTTGCTCCCCTAAAGGGTGG + Intergenic
996345008 5:122478250-122478272 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
996358793 5:122623438-122623460 GTTCTTGCCCTCCAGAAAAGCGG + Intergenic
996372474 5:122768119-122768141 TTTCTTGAACACCATAAAGGGGG - Intergenic
996509677 5:124304633-124304655 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
996575174 5:124971170-124971192 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
996575192 5:124971229-124971251 GTGCTTGCCCCCCAGAAAAGTGG + Intergenic
996745731 5:126844651-126844673 GTTCTTGCCCCGTAGAAAAGCGG + Intergenic
996855092 5:127996941-127996963 TTTCTTAGCCCCCAGAAAGTTGG + Intergenic
997746225 5:136302412-136302434 GTTCTTGTCCCCTAGAAAAGCGG - Intronic
997746243 5:136302470-136302492 GTTCTTACCCTCCAGAAAAGTGG - Intronic
997769875 5:136544354-136544376 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
997772875 5:136570199-136570221 GTTCTTGCCCCATAGAAAAGTGG + Intergenic
997788744 5:136737892-136737914 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
997788772 5:136738009-136738031 GTGCTTGCCCCACAGAAAAGTGG - Intergenic
998359957 5:141576476-141576498 CTTCTTGCCACCCAGCATGGTGG - Intronic
1000439557 5:161249629-161249651 GTTCTTACCCCCCAGAAAAGTGG - Intergenic
1000519639 5:162280205-162280227 TTTCTTGCCCACCAGAAAGGTGG + Intergenic
1000885493 5:166743652-166743674 ATACTTGCCCCCCAGGAAAGTGG + Intergenic
1000885509 5:166743711-166743733 GTTCTTGCCCCCCAGAAAAGCGG + Intergenic
1000885525 5:166743771-166743793 GTTCTTGCCTCCCAGAAAAGCGG + Intergenic
1000935862 5:167302665-167302687 GTTCTTGCACCCTAGAAAAGTGG + Intronic
1001331704 5:170766925-170766947 TTCTTGCCCCCCCAGAAAGGTGG + Intronic
1002394439 5:178941902-178941924 CTTCTTCCTCCTCAGAAAGGAGG - Intronic
1002611160 5:180419406-180419428 TTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1002615916 5:180455972-180455994 TCTTCTGCCTCCCAGAAAGGTGG - Intergenic
1004105988 6:12668103-12668125 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
1004106100 6:12668552-12668574 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1004283761 6:14301786-14301808 GTTCTTGCCCCATAGAAAAGCGG + Intergenic
1004508247 6:16263947-16263969 TTTCTTGCCCCCCAGAAAGGCGG + Intronic
1004575010 6:16886901-16886923 TTTCTTGTCCCCCAGAAAGGTGG - Intergenic
1004768743 6:18758608-18758630 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1004818330 6:19336986-19337008 TTTCTGGCCAGGCAGAAAGGAGG + Intergenic
1005014870 6:21366219-21366241 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1005367186 6:25090377-25090399 TTTCTTCCCCCACAAAATGGGGG + Intergenic
1005556656 6:26992105-26992127 TTGCATGCTCCCCAGAAAAGGGG - Intergenic
1008221592 6:48860894-48860916 CTTCTTGCCCACCATATAGGAGG - Intergenic
1008476329 6:51939198-51939220 GTTCTTGCCCCCCAGAAAAGTGG - Intronic
1008476348 6:51939259-51939281 GTTCTTGCCCCCCAGAAAAGCGG - Intronic
1008476362 6:51939318-51939340 GTTCTTGCCCCCTAGAAAAGCGG - Intronic
1008683495 6:53899500-53899522 TTCCTTGCCTGCCTGAAAGGTGG + Intronic
1008850378 6:56015366-56015388 GTTCTTGCCCTCCAGAAAAGCGG + Intergenic
1008850392 6:56015425-56015447 GTTCTTGCCCCTTAGAAAAGTGG + Intergenic
1008850408 6:56015485-56015507 TTTCTTGCCACCCAGAAAAATGG + Intergenic
1008850424 6:56015544-56015566 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1008850439 6:56015604-56015626 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1008850519 6:56015904-56015926 GTTCTTGCCCCCCAGAAAAGCGG + Intergenic
1009269637 6:61601197-61601219 ATGCTTGCCCCCCAGGAAAGTGG - Intergenic
1009343398 6:62586903-62586925 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
1009343448 6:62587112-62587134 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1009359152 6:62792484-62792506 TTTCTTGCCCCCCATTAAAGTGG - Intergenic
1009359184 6:62792603-62792625 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1009598542 6:65767940-65767962 TTTCTTGCCCCCTAGACAAGTGG + Intergenic
1010071907 6:71753180-71753202 GTTCTTGCCACCCAGAAAAGTGG + Intergenic
1010586907 6:77665278-77665300 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1010841481 6:80652384-80652406 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1010894801 6:81350131-81350153 GTTCTTGCCCCATAGAAAAGTGG + Intergenic
1011368080 6:86602952-86602974 ATTCTTGCCCCCCAGAAAAGTGG + Intergenic
1011771136 6:90674855-90674877 GTTCTTGCACCCTAGAAAAGCGG + Intergenic
1012066726 6:94558568-94558590 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1012593828 6:101017067-101017089 TTTCTTGAACACCATAAAGGTGG - Intergenic
1012689354 6:102293813-102293835 GTTCTTGCCCCGTAGAAAGCAGG - Intergenic
1013408043 6:109860286-109860308 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1013408118 6:109860623-109860645 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
1013465436 6:110413778-110413800 TTTTTTTTCCCCCTGAAAGGGGG + Intronic
1013843946 6:114427327-114427349 GTTCTTGCCCCGTAGAAAAGCGG + Intergenic
1013891495 6:115032882-115032904 GTTCTTTCCCCCTAGAAAAGCGG - Intergenic
1014360386 6:120467085-120467107 GTTCTTGCCCCGTAGAAAAGTGG + Intergenic
1014395845 6:120926008-120926030 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1014455071 6:121625127-121625149 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1014498657 6:122158900-122158922 TTTTTTTTCTCCCAGAAAGGTGG + Intergenic
1014611891 6:123557724-123557746 GTGCTTGCCCCCCAGAAAAGCGG - Intronic
1014611908 6:123557782-123557804 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1014614829 6:123586821-123586843 GTTCTTACCCTCCAGAAAAGCGG + Intronic
1014614888 6:123587072-123587094 TTTCTTGCCCCCCAGAAAGGTGG + Intronic
1014718427 6:124891489-124891511 GTTCTTGCCCCCTAGAAAAGAGG - Intergenic
1014891355 6:126849799-126849821 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1015082101 6:129239584-129239606 TTTCTATCACCCCAGACAGGTGG + Intronic
1015164993 6:130193233-130193255 TTTCTTGCCCCCCAGAAAGGCGG - Intronic
1015165057 6:130193503-130193525 GTTCTTACCCTCCAGAAAAGCGG - Intronic
1015271192 6:131339964-131339986 GTTCTTGCCCCCTAGGAAAGCGG - Intergenic
1015277978 6:131403943-131403965 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1015876131 6:137824610-137824632 TTTCCTTCCCCCAAGAAAGAAGG - Intergenic
1016114311 6:140261951-140261973 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1016518639 6:144924318-144924340 GTTCTTGCACCCTAGAAAAGTGG - Intergenic
1016535905 6:145107674-145107696 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1016535963 6:145107925-145107947 TTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1016853045 6:148640691-148640713 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
1017779541 6:157705421-157705443 TTTCTTGCCTCCCAGAAAGGCGG + Intronic
1018077419 6:160229589-160229611 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1018084661 6:160291114-160291136 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1018495567 6:164343283-164343305 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1018521637 6:164656695-164656717 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1018521706 6:164656988-164657010 TTTCTTGTCCTCCAGAAAGGTGG + Intergenic
1018521739 6:164657109-164657131 TTTCTTGTCCCCCAGAAAGGCGG + Intergenic
1020324101 7:6961221-6961243 GTTCTTGCCTTCCAGAAAAGAGG + Intergenic
1020541289 7:9463057-9463079 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1021179442 7:17488783-17488805 TTCCTTAACCTCCAGAAAGGTGG + Intergenic
1021393422 7:20121627-20121649 GTTCCTGCCCCCCAGAGAAGCGG - Intergenic
1021393452 7:20121745-20121767 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
1021442185 7:20689238-20689260 TTTCTTCTCTCCCAGCAAGGCGG + Intronic
1021637097 7:22704245-22704267 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
1021637114 7:22704305-22704327 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1021637150 7:22704427-22704449 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1021810460 7:24397283-24397305 GTTCTTGCCCCGTAGAAAAGCGG - Intergenic
1022039539 7:26567103-26567125 ATTCTTACCCCCCGTAAAGGTGG - Intergenic
1022359175 7:29642634-29642656 CTTCTTGCCCCCCTGGATGGTGG + Intergenic
1022372719 7:29786058-29786080 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1022710208 7:32842431-32842453 GTTCTTTCCCCCTAGAAAAGCGG + Intergenic
1022854875 7:34304417-34304439 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1022854903 7:34304518-34304540 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1023699092 7:42875312-42875334 GTTCTTGCCCCATAGAAAAGCGG + Intergenic
1023780605 7:43651746-43651768 TGTCTTGGCCTCCTGAAAGGTGG - Intronic
1024602371 7:50995102-50995124 TTTCGTGCCCCACAGAAGGGAGG - Intergenic
1025993941 7:66516421-66516443 TTTTTTTCCCCCCAGAGATGGGG - Intergenic
1027157610 7:75779903-75779925 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1027157638 7:75780005-75780027 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1027157656 7:75780068-75780090 GTGCTTGCCCCCCAGAAAAGTGG - Intronic
1027157667 7:75780105-75780127 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1027157689 7:75780180-75780202 GTGCTTGCCCCCCAGGAAAGTGG - Intronic
1027608790 7:80333478-80333500 TTTCTTCCCTTCCAGAATGGCGG - Intergenic
1027641324 7:80736846-80736868 TTTCTTCTCCTCTAGAAAGGAGG + Intergenic
1028689970 7:93640866-93640888 TTCCTTGCCCCCTAGAAAGGTGG - Intronic
1028690013 7:93641031-93641053 GTTCTTACCCTCCAGAAAAGTGG - Intronic
1029500010 7:100923129-100923151 GTTCTTGCCCCCCAGAAAAGCGG - Intergenic
1029500038 7:100923247-100923269 GTTCTTGCCCCTCAGAAAAGTGG - Intergenic
1030445949 7:109646680-109646702 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1030751665 7:113238106-113238128 GTTCTTGCCCCCTAGAAAAGAGG + Intergenic
1031004484 7:116456588-116456610 GTTCTTGCCCCCTAGAAAAGTGG - Intronic
1031355362 7:120781684-120781706 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1031355428 7:120781945-120781967 GTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1031355442 7:120782004-120782026 ATTCTTGCCCCACAGAAAAGCGG + Intergenic
1031364960 7:120890438-120890460 TTTCTTGCCCCCTAGAAAGGTGG + Intergenic
1031399826 7:121316753-121316775 GTTCTTGTCCCCTAGAAAAGCGG - Intergenic
1031728125 7:125263582-125263604 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1033465209 7:141583364-141583386 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
1033465241 7:141583495-141583517 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
1033676156 7:143541910-143541932 GATCTTGCCCCCTAGAAAAGCGG + Intergenic
1033695677 7:143787529-143787551 GATCTTGCCCCCTAGAAAAGCGG - Intergenic
1033909705 7:146248278-146248300 TTTCTTGCCCCCCAGAAAGGCGG + Intronic
1034084998 7:148314603-148314625 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
1034085029 7:148314722-148314744 GTTCTTGCCCTCCAGAAAAGCGG + Intronic
1035880833 8:3242770-3242792 TTTCTTACCCTCCAGACAAGCGG + Intronic
1036071071 8:5441110-5441132 ATTTTTGCCTCCCAGAAAAGTGG + Intergenic
1036071112 8:5441295-5441317 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1036071128 8:5441355-5441377 CTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1036071145 8:5441414-5441436 GTTCTTGCCCCCCAGAAAAGCGG + Intergenic
1036281261 8:7403315-7403337 GTTCTTGCCCCATAGAAAAGCGG - Intergenic
1036340205 8:7908257-7908279 GTTCTTGCCCCATAGAAAAGCGG + Intergenic
1036472587 8:9064309-9064331 GTTCTTGCACCCCAGAAAAGCGG + Intronic
1036639260 8:10572103-10572125 TTTCTTGTCCCCTAGAAAAGTGG - Intergenic
1036639333 8:10572428-10572450 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1040561012 8:48523505-48523527 CTTCCTGCCCCCCAGAAAAGAGG - Intergenic
1040647847 8:49420617-49420639 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1040983105 8:53266114-53266136 GTTCTTCCACCCCAGAAAGCTGG - Intergenic
1041652020 8:60311087-60311109 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1042792281 8:72621435-72621457 TCTCTTGCTTCCCAGAAAGTTGG + Intronic
1043353868 8:79390771-79390793 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1043598672 8:81914568-81914590 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1043718058 8:83509671-83509693 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1043718130 8:83509987-83510009 TTTCTTGCCCCCCAGAAAGGTGG + Intergenic
1043837514 8:85063890-85063912 GTTCTTGCCTCCTAGAAAAGTGG - Intergenic
1044148688 8:88746815-88746837 GTTCTTGTCCCCTAGAAAAGCGG + Intergenic
1044258801 8:90094828-90094850 GTTCTTGCCCCCTAGAAAAGCGG + Intronic
1044416897 8:91949070-91949092 GTTCTTGCCCCCTAGGAAAGTGG - Intergenic
1044921793 8:97176162-97176184 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1044921823 8:97176263-97176285 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1044924957 8:97201923-97201945 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1045034908 8:98169355-98169377 TTTTTTTCCCCCCAGAAAGAGGG + Intergenic
1046063162 8:109163639-109163661 TTTCTTAACACCCAGATAGGTGG + Intergenic
1046667426 8:117019596-117019618 TTTCTTGCCCTCAAGAAGGAAGG - Intronic
1046748470 8:117901035-117901057 TTTCTTGCAGACCAGAAAGCTGG - Intronic
1047856213 8:128915574-128915596 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1048097385 8:131311087-131311109 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
1048135285 8:131741738-131741760 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1048604424 8:135952845-135952867 TTTCTTGGTACCCAGAAAGAAGG - Intergenic
1050117387 9:2276563-2276585 GTTCTTGCCCCGCAGAAAAGCGG - Intergenic
1050117401 9:2276620-2276642 TTTCTTGCCCTCCAGAAAAGTGG - Intergenic
1050473958 9:6020986-6021008 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1050473977 9:6021044-6021066 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1051126754 9:13813545-13813567 TTTCTTGCTGCCCATAAAGGTGG + Intergenic
1051849485 9:21490386-21490408 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1052162926 9:25288854-25288876 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1052191608 9:25669844-25669866 GTTCTTGCCCTCCAGAAAAGTGG - Intergenic
1052191622 9:25669903-25669925 GTTTTTGCCCCCTAGAAAAGCGG - Intergenic
1052653080 9:31327213-31327235 TTTCTTGCCCCCCAGAAAAGCGG - Intergenic
1052653092 9:31327273-31327295 GCTCTTGCCTCCCAGAAAAGCGG - Intergenic
1052653108 9:31327332-31327354 GTTCTTGCCCCCTGGAAAAGTGG - Intergenic
1052720803 9:32169061-32169083 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1053057770 9:35004283-35004305 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1055347886 9:75356335-75356357 GTTCTTGCCCTCCAGAAAAGTGG + Intergenic
1055347927 9:75356513-75356535 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1055347943 9:75356572-75356594 GTCCTTACCCCCCAGAAAAGCGG + Intergenic
1055347961 9:75356631-75356653 GTTCTTGTCCCCCAGAAAAGTGG + Intergenic
1055604981 9:77959847-77959869 ATTCAGGCCCCCCAAAAAGGTGG + Intronic
1055665780 9:78551390-78551412 TATCTTCCTTCCCAGAAAGGTGG + Intergenic
1056044904 9:82705237-82705259 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1056060976 9:82884831-82884853 GTTCTTGCCCCGTAGAAAAGTGG - Intergenic
1056153864 9:83816352-83816374 TTTCTTGGCCTGCAGAAAGTGGG - Intronic
1056323631 9:85459421-85459443 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1056356631 9:85806756-85806778 TTTCTTGGCCTACAGAAAGTGGG + Intergenic
1056437424 9:86587952-86587974 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1057377786 9:94540832-94540854 GTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1057981820 9:99670873-99670895 GTTCTTGCCCCGTAGAAAAGCGG - Intergenic
1058026436 9:100145513-100145535 GTTCTTGCCCCCTAGAAAAGTGG + Intronic
1059551513 9:115233869-115233891 CTGCTGGCCCCTCAGAAAGGGGG + Intronic
1059606901 9:115843881-115843903 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1059863682 9:118490350-118490372 GTTCTTGCCCCCTAGGAAAGCGG + Intergenic
1060154614 9:121310669-121310691 TCTTTGGCCCCACAGAAAGGAGG + Exonic
1060192360 9:121600964-121600986 TTTCCTCTCCCCCAGAAAGTTGG + Intronic
1061329608 9:129884365-129884387 GTTCTTGCACTACAGAAAGGTGG + Intergenic
1061582892 9:131548224-131548246 ATGCTTGCCCCCCAGGAAAGTGG - Intergenic
1061998792 9:134205354-134205376 TTTCTTGCCCCTCTGGTAGGTGG - Intergenic
1062216106 9:135390644-135390666 TCTCCTGCCCCCCAGACTGGTGG - Intergenic
1185960852 X:4545012-4545034 TTTCTTGCCCCCTAGAAAAGTGG + Intergenic
1186113040 X:6276731-6276753 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1186113106 X:6276984-6277006 TTTCTTACCCCCCAGAAAGGCGG + Intergenic
1186783875 X:12940863-12940885 ATTCTTGCCCCCTAGAAAAGCGG - Intergenic
1187086746 X:16049481-16049503 TTTCTTGCCCCCCAGAAAGGCGG + Intergenic
1187100086 X:16183365-16183387 TGTCTTGCCCCCCAGAAAGGTGG + Intergenic
1187100114 X:16183482-16183504 TTTCTTGCCCCCCAGAAAGGCGG + Intergenic
1187200849 X:17132449-17132471 CTTCTTGGCTCCCAGAAAGAGGG - Intronic
1188463535 X:30453614-30453636 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1188552468 X:31378626-31378648 GTTCTTGCCCCCGAGAAAAGCGG - Intronic
1188552484 X:31378684-31378706 GTTCTTGTCCCCCAGAAAAGCGG - Intronic
1189031989 X:37460376-37460398 GTGCTTGCCCCCCAGGAAAGTGG + Intronic
1190230340 X:48577011-48577033 TTTTTTCCCCCCCAGAAACCAGG + Exonic
1191192612 X:57682546-57682568 TCTCTTGCCCCAAAGAAAGCAGG - Intergenic
1192437576 X:71152414-71152436 TTTCCCCCACCCCAGAAAGGTGG + Intronic
1192705930 X:73528681-73528703 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1194052223 X:89083902-89083924 ATTTTTCCCCCCCAGAAAAGTGG + Intergenic
1194293808 X:92104893-92104915 GTTCTTGCCCCCTAGGAAAGCGG + Intronic
1194366889 X:93023892-93023914 TCTCTTGCCCCCCAGAAAGGTGG - Intergenic
1194366943 X:93024101-93024123 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1194822960 X:98528961-98528983 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1194873968 X:99163973-99163995 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1195291344 X:103434171-103434193 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1195291366 X:103434229-103434251 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1195291387 X:103434291-103434313 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1195327032 X:103766345-103766367 ATGCTTGCCCCCCAGGAAAGTGG + Intergenic
1195841250 X:109179301-109179323 TTTCTTGCCCCCCAGAAAGGTGG - Intergenic
1195908868 X:109869878-109869900 TTTCTTGCCCCCTAGGAAAGTGG + Intergenic
1196221189 X:113113444-113113466 GTTCTTGTCCCCCAGAACAGTGG + Intergenic
1196221206 X:113113503-113113525 GTTCTTGCCCCCCAGAAAAGCGG + Intergenic
1196341946 X:114606134-114606156 GTTCTTGCCCCATAGAAAAGCGG + Intronic
1196525677 X:116725636-116725658 ATTCCTGCCCCCTAGAAAAGTGG + Intergenic
1196525695 X:116725696-116725718 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1196525726 X:116725814-116725836 GTTCTTGCCCCCCAGAAAAGTGG + Intergenic
1196533730 X:116817164-116817186 GTTCTTGCCCCCTAGGAAAGTGG + Intergenic
1196572346 X:117280350-117280372 TTTCTTGCCCCCTAGAAAAGCGG - Intergenic
1196774014 X:119322290-119322312 GTTCTTACCCTCCAGAAAAGCGG + Intergenic
1196774051 X:119322433-119322455 GTTCTTGCCCCCTAGAAAAGCGG + Intergenic
1196992893 X:121347675-121347697 GTTCTTGCCCCTTAGAAAAGCGG + Intergenic
1196992908 X:121347734-121347756 GTTCTTGCCTCCTAGAAAAGCGG + Intergenic
1196992922 X:121347792-121347814 GTTCTTGCCCCCTGGAAAAGCGG + Intergenic
1197932861 X:131712970-131712992 TTTCTTGCCACCCAGAAAGGCGG - Intergenic
1198598228 X:138259646-138259668 ATTCTTGCCCCCTAGAAAAGCGG - Intergenic
1198598294 X:138259955-138259977 GTTCTTACCCTCCAGAAAAGCGG - Intergenic
1198599552 X:138268836-138268858 GTTCTTACCCTCCAGAAAAGTGG + Intergenic
1198965731 X:142227623-142227645 ATGCTTGCCCCCCAGGAAAGTGG - Intergenic
1198965745 X:142227688-142227710 GTGCTTGCCCCCCAGGAAAGTGG - Intergenic
1199377791 X:147133641-147133663 GTTCTTGCCCCCTAGGAAAGTGG + Intergenic
1199377809 X:147133703-147133725 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1199377829 X:147133765-147133787 GTGCTTGCCCCCCAGGAAAGTGG + Intergenic
1199576291 X:149316744-149316766 TTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1199576319 X:149316844-149316866 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1200611325 Y:5329434-5329456 GTTCTTGCCCCCTAGGAAAGCGG + Intronic
1200675111 Y:6140148-6140170 TCTCTTGCCCCCCAGAAAGGTGG - Intergenic
1200675165 Y:6140357-6140379 GTTCTTACCCTCCAGAAAAGTGG - Intergenic
1201234418 Y:11895720-11895742 GTACTTGCCCCCCAGGAAAGTGG + Intergenic
1201473671 Y:14359053-14359075 GTGCTTGCCCCCTAGAAAAGTGG + Intergenic
1201936874 Y:19419468-19419490 GTTCTTGCCCCCTAGAAAAGTGG - Intergenic
1201936926 Y:19419750-19419772 GTTCTTACCCTCCAGAAAAGTGG - Intergenic