ID: 949670934

View in Genome Browser
Species Human (GRCh38)
Location 3:6398564-6398586
Sequence GGGTTTCTTGCCCCCCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670934_949670946 30 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC No data
Right 949670946 3:6398617-6398639 AGTCCCGCTTTTGTAGGGGAAGG No data
949670934_949670945 26 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC No data
Right 949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG No data
949670934_949670944 25 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC No data
Right 949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG No data
949670934_949670941 5 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC No data
Right 949670941 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
949670934_949670943 24 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC No data
Right 949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670934 Original CRISPR GGGTTTCTTGCCCCCCAGAA AGG (reversed) Intergenic