ID: 949670934

View in Genome Browser
Species Human (GRCh38)
Location 3:6398564-6398586
Sequence GGGTTTCTTGCCCCCCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 70, 1: 42, 2: 9, 3: 11, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670934_949670943 24 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC 0: 70
1: 42
2: 9
3: 11
4: 128
Right 949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG No data
949670934_949670941 5 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC 0: 70
1: 42
2: 9
3: 11
4: 128
Right 949670941 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
949670934_949670944 25 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC 0: 70
1: 42
2: 9
3: 11
4: 128
Right 949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG No data
949670934_949670945 26 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC 0: 70
1: 42
2: 9
3: 11
4: 128
Right 949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG No data
949670934_949670946 30 Left 949670934 3:6398564-6398586 CCTTTCTGGGGGGCAAGAAACCC 0: 70
1: 42
2: 9
3: 11
4: 128
Right 949670946 3:6398617-6398639 AGTCCCGCTTTTGTAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670934 Original CRISPR GGGTTTCTTGCCCCCCAGAA AGG (reversed) Intergenic
904711428 1:32433275-32433297 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
905499567 1:38426049-38426071 GAGTTTCTTGCCCCCCAGAAAGG - Intergenic
905824183 1:41016676-41016698 GGGTTTCAGGCACCCCTGAAGGG + Intronic
906080701 1:43086443-43086465 GGGTTTCTTGCCTCCCAGAAAGG - Intergenic
907503788 1:54902650-54902672 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
907703476 1:56812723-56812745 GTGTTTATTGCCCCTCAGCATGG - Intronic
909788477 1:79643535-79643557 GGGTTTCTTGCCCCCCAGAATGG + Intergenic
910418587 1:87029933-87029955 TGGTTTCTTGCCCAGAAGAAAGG + Intronic
912296266 1:108473910-108473932 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
913034757 1:114953093-114953115 GGGATTCCTGCCACCCATAAGGG + Intronic
914680506 1:149935428-149935450 AGGGTTGTTGCCCCCTAGAAGGG - Intronic
918010405 1:180581420-180581442 GGGTTTTTTCTTCCCCAGAATGG + Intergenic
918373510 1:183884865-183884887 GAGTTCTTTGCCCCCCAGGATGG - Exonic
919476157 1:198035583-198035605 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
921509054 1:216008946-216008968 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
922934599 1:229413327-229413349 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
923074996 1:230602173-230602195 GGATTTCTTGCCCCCCAGAAAGG - Intergenic
923925877 1:238626764-238626786 GGACTTCTTGGCCCCCACAATGG - Intergenic
924444604 1:244117565-244117587 GGGTCTCTCCCCTCCCAGAAAGG - Intergenic
1064887221 10:20123997-20124019 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
1065916516 10:30358205-30358227 GGCTTTCTGACCACCCAGAAGGG + Intronic
1066064571 10:31752783-31752805 AGGTTTCATGACCCCCAGAATGG - Intergenic
1070805498 10:79268388-79268410 TGGTTTCCTGCCCCCAGGAATGG + Intronic
1070815688 10:79321664-79321686 GGGTGCCTTGCCCTGCAGAAGGG - Intergenic
1071960876 10:90808250-90808272 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
1071960903 10:90808370-90808392 GAGTTTCTTGCCCCCCAGAAAGG - Intronic
1072082089 10:92042853-92042875 GGATTTTTTGACCTCCAGAACGG + Intergenic
1074740559 10:116481609-116481631 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1077006841 11:362370-362392 GGGTGGCTTGCCGCCCACAATGG + Intergenic
1077244345 11:1528859-1528881 GGGTTTCTGGCCCCACAGGGTGG - Intergenic
1078060595 11:8040259-8040281 ATGTTTCTTGGCCCACAGAATGG + Intronic
1079688957 11:23398469-23398491 GGGGATCTTGCCACCCTGAAGGG + Intergenic
1079727302 11:23891978-23892000 GGCTTTCTGGCCCCCAAGAAAGG + Intergenic
1080686701 11:34522057-34522079 GAGTTTCTTTGCTCCCAGAAAGG - Intergenic
1082228705 11:49739284-49739306 GAGTTTTTTCCCCCCCACAATGG + Intergenic
1082909410 11:58353672-58353694 GGGCTTCCTGGACCCCAGAAAGG + Intergenic
1084145432 11:67262703-67262725 GGTTTTCTTCCCCACCAGACTGG + Intergenic
1084232083 11:67760610-67760632 GGGTTTCTTGTCCCCCAGAAAGG - Intergenic
1084355339 11:68634660-68634682 GGGTTTCTTGCCCCGCAGAAAGG - Intergenic
1084613488 11:70219087-70219109 GGGTTTCTTGCCTTACAGAAAGG + Intergenic
1084613514 11:70219208-70219230 GGATTTCTTGCCCTCCAGAAAGG + Intergenic
1085206018 11:74732265-74732287 AGTTTTCTTTCCCACCAGAAGGG + Intergenic
1085517203 11:77118511-77118533 GGGCTTCATGACCCCCAGATGGG - Intronic
1085987792 11:81807091-81807113 GGGGTTCTTGCCTCCCAGAAAGG - Intergenic
1087127592 11:94642520-94642542 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1089472295 11:118730903-118730925 GGGTTTCTTGCACCCCAGAAAGG + Intergenic
1089987174 11:122825357-122825379 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1089987207 11:122825478-122825500 GGGTTTCTTGCCCTCCAGAAAGG - Intergenic
1089987221 11:122825537-122825559 GGGTTTCTTGCCCTCCAGAAAGG - Intergenic
1091206939 11:133828161-133828183 GGTTTTCATGCCCCCTGGAAAGG + Intergenic
1092474251 12:8805796-8805818 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1092789497 12:12059303-12059325 GGGTTTCTTGCACCCCAGAAAGG - Intronic
1097770010 12:63572493-63572515 GGGGATCTTGCCACCCTGAAGGG + Intronic
1099292321 12:80787950-80787972 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1099471832 12:83059693-83059715 GGTTTTACTGCCCCCCAAAATGG - Intronic
1101722410 12:107361590-107361612 GCTTTGATTGCCCCCCAGAAAGG + Intronic
1103514832 12:121500682-121500704 GGGTCTCTTTCCCCATAGAAGGG - Intronic
1108116170 13:47130608-47130630 GGGTTCCTTGCCCCCTGGGATGG + Intergenic
1109625029 13:64963011-64963033 GAGTTTCTTGGCCTCCAGCAAGG - Intergenic
1110765242 13:79275013-79275035 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1115727967 14:36237938-36237960 GGGTCTCTTTTCTCCCAGAAGGG - Intergenic
1115761186 14:36580499-36580521 GGGAGTCGTGCCCCCCAGACCGG - Intergenic
1116534992 14:46017152-46017174 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1116703533 14:48267326-48267348 TGGTTTCTTGCCCCTCAGAAAGG + Intergenic
1117901265 14:60535802-60535824 GGGTTTTTTGCCTCCCTGATTGG + Intergenic
1119022181 14:71125141-71125163 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1119022212 14:71125258-71125280 GGGGTTTTTTCCTCCCAGAAAGG - Intergenic
1119137826 14:72236919-72236941 GGCATTCTTACCACCCAGAATGG + Intronic
1120539741 14:85737591-85737613 GGGGTTCTTGCCCCCAGAAAAGG + Intergenic
1120660187 14:87239839-87239861 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1121145749 14:91580568-91580590 GGGGTTCTGACCCCACAGAATGG + Intergenic
1123124105 14:105932861-105932883 TGGATCCTTGCCCCCCAGCACGG + Intergenic
1124483967 15:30100089-30100111 GGCTTTCTGACCCCCCAGAGGGG - Intergenic
1124519613 15:30397135-30397157 GGCTTTCTGACCCCCCAGAGGGG + Intergenic
1124539040 15:30569086-30569108 GGCTTTCTGACCCCCCAGAGGGG - Intergenic
1124759610 15:32438486-32438508 GGCTTTCTGACCCCCCAGAGGGG + Intergenic
1125848915 15:42885638-42885660 GGGGTACTTGCCCCCCAGAAAGG - Intronic
1126461158 15:48916584-48916606 GGGTTTCTTCCTACACAGAATGG + Intronic
1126843530 15:52739512-52739534 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1130879056 15:88039483-88039505 AGGTGTCTTTCCCCACAGAATGG + Intronic
1132340199 15:101073464-101073486 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
1132376798 15:101333486-101333508 GGGTTTCTTGGCAATCAGAATGG + Intronic
1133651177 16:7815610-7815632 GGGTTTCTTGCTCCCCAGAAAGG - Intergenic
1134228087 16:12407650-12407672 GAGTTTCTTACCCCACAGGATGG - Intronic
1134347773 16:13407190-13407212 GGACTTCTTGGCCTCCAGAATGG - Intergenic
1134594993 16:15489040-15489062 GGGTTTCTTTTCCCCCAGGGGGG + Intronic
1137513090 16:49118327-49118349 GCGTTTCTGTCCACCCAGAAGGG + Intergenic
1142265749 16:89063325-89063347 AGGCTTCTTGCCCCCCAGGTAGG - Intergenic
1142376972 16:89711511-89711533 GGGTCTCCTGCACCCCAGGACGG - Intronic
1147578845 17:41617494-41617516 GGGTTTCTTCCCCAGCAGAGGGG + Intergenic
1148018776 17:44540109-44540131 AAGTTTCTTGTTCCCCAGAAAGG + Intergenic
1155941327 18:31804697-31804719 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1158394878 18:57071501-57071523 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1160443898 18:78912894-78912916 GCGTTTCTTGGGCCCCAGACTGG - Intergenic
1161476941 19:4491441-4491463 GGGTTCCTGGCCCGCCAGAGAGG + Intronic
1165321846 19:35090481-35090503 GGGTGTCTTGATCCCCAGGATGG - Intergenic
1167901937 19:52628718-52628740 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
1168228185 19:55011481-55011503 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
927937095 2:27082258-27082280 GGGTTTCATGCACCCCAGGGCGG - Exonic
928378607 2:30799437-30799459 GGGATTAGTGGCCCCCAGAAAGG + Intronic
929076905 2:38085580-38085602 GGATTTCTTGCCCCCCAGAAAGG + Intronic
930022490 2:47009725-47009747 GGGTTGCTTGGCCCACAGTAGGG + Intronic
931042480 2:58315083-58315105 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
931646263 2:64424674-64424696 GGGGTCCTTGGCCCCCAGAGGGG - Intergenic
932295607 2:70621423-70621445 GGGTTTCTTGCCCCTCAGAAAGG - Intronic
932295639 2:70621545-70621567 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
932489643 2:72112613-72112635 GGCTTTCTTGGCCCCCAGGCCGG - Intergenic
933163529 2:79052313-79052335 AGGTTTTCTGCCCCCCAGAAAGG - Intergenic
936460511 2:112710973-112710995 GGGTTTCTTGCCCATCAGTCTGG + Intergenic
937137006 2:119562459-119562481 GGCTGTCTTGCCCCCATGAAGGG - Intronic
939244733 2:139609425-139609447 GGGGTACTTGCCACCCTGAAGGG - Intergenic
939512607 2:143125142-143125164 GGGTTTCTAGTCCCTCTGAACGG - Intronic
939547439 2:143570902-143570924 GGGTTTCCAGCCCCCCAGCCAGG + Intronic
940294617 2:152109729-152109751 GGGTTTCCTGACCCTCAGACTGG + Intergenic
940529975 2:154868251-154868273 GGGTTTCTTGACCCCCAGAAAGG - Intergenic
940676030 2:156724893-156724915 GGGTTTCTTGCCTGCTAGAAAGG + Intergenic
941453750 2:165691862-165691884 GGATGTCTTCCACCCCAGAAAGG + Intergenic
941777411 2:169407885-169407907 GGTTTTCTTCCCCCCCTTAATGG - Intergenic
943866965 2:192937860-192937882 GGGGATCTTGCCACCCTGAAGGG - Intergenic
944387233 2:199180340-199180362 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
944876345 2:203966734-203966756 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
945375883 2:209078997-209079019 GGGTTTCTTTCCCCCCAGAAAGG - Intergenic
946886287 2:224226255-224226277 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
946893047 2:224297568-224297590 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
946912357 2:224476823-224476845 GGGCTTTTTCCCCCCCAAAATGG - Intronic
948390428 2:237607711-237607733 GTGTTTCTTGCCCCCCAGAAAGG - Intergenic
1169295586 20:4394588-4394610 GGGTGGCTTGCCGCCCACAATGG + Intergenic
1171317446 20:24207425-24207447 GGGGTTCCTGCCCCAAAGAAGGG - Intergenic
1171876303 20:30580285-30580307 GGCCTTCTTTCCTCCCAGAAAGG + Intergenic
1173781425 20:45760277-45760299 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
1174518408 20:51111196-51111218 GGGATTCATGTCCCCCATAAAGG - Intergenic
1174717742 20:52777892-52777914 GGGTTTCTTGGGCCTGAGAAGGG + Intergenic
1178493496 21:33069121-33069143 GGGTTTCTATCCTCCCCGAAAGG - Intergenic
1179651076 21:42809226-42809248 GGATCTCTGGCCCCCCAGGAAGG - Intergenic
1180852637 22:19029359-19029381 GGGTTCCCTGCGCCCCAGACCGG + Intergenic
1181808597 22:25390331-25390353 ACGGTTCTTGCCCCCGAGAAGGG - Intronic
1183454972 22:37917708-37917730 TGGTGTCTCGCCACCCAGAAAGG + Exonic
1184100845 22:42341152-42341174 GGTTTGCATCCCCCCCAGAAAGG - Intronic
949162312 3:895458-895480 AGGTTTCTTGCCCCCCAGAAAGG + Intergenic
949670934 3:6398564-6398586 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
949827222 3:8177943-8177965 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
950926271 3:16745206-16745228 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
951299024 3:20972275-20972297 GGGTTTCTTGCCCCCCAGTAAGG + Intergenic
952627230 3:35420481-35420503 GGGTTTTTTTGCCCACAGAAGGG + Intergenic
953077366 3:39582671-39582693 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
953176957 3:40561821-40561843 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
953201705 3:40783629-40783651 GGGTTCCTGGGCCCCCAGATGGG - Intergenic
953908034 3:46878133-46878155 GGCTTTCTTGCCTCTCAGGAAGG - Intronic
960471774 3:118075156-118075178 GGGTAACTTGCCACCCTGAAGGG - Intergenic
961880837 3:130060197-130060219 GGGTTTCTTGCCCCCCTGAAAGG - Intergenic
963456891 3:145555964-145555986 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
963663093 3:148152472-148152494 GGATTTATTGCCCCCCAGAAAGG - Intergenic
964101338 3:152991899-152991921 GGGTGTCTTGCCGCCCACACTGG - Intergenic
964906743 3:161726702-161726724 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
965059931 3:163772769-163772791 GGGGATCTTGCCACCCAGAAGGG - Intergenic
965625103 3:170677314-170677336 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
965626532 3:170688139-170688161 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
965626564 3:170688258-170688280 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
965640272 3:170822819-170822841 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
966066584 3:175828460-175828482 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
967212364 3:187180212-187180234 GGAGTTCTTGCCCCCTAGAAAGG + Intronic
967244382 3:187471056-187471078 GGGTTTCTTGTCCCCCAGAAAGG + Intergenic
967496021 3:190145513-190145535 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
967644042 3:191900154-191900176 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
967658337 3:192075909-192075931 GGGTTTCTTGTCCCCCAGAAAGG + Intergenic
967719619 3:192801701-192801723 GGCTTTCTTGACATCCAGAATGG + Intronic
970256641 4:14175302-14175324 GGGTTTTTTGCCCCCCAGAAAGG + Intergenic
972278362 4:37580833-37580855 GGGTATCTTGTCACCCTGAAGGG - Intronic
976884784 4:89969531-89969553 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
979054819 4:115980335-115980357 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
979146410 4:117253032-117253054 AGATTTCTTGCCCCCCAGAAAGG - Intergenic
980575843 4:134682610-134682632 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
982084158 4:151817283-151817305 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
982414404 4:155113239-155113261 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
982497349 4:156108359-156108381 GGGTTTCTTGCCCCCCGGAAAGG + Intergenic
982588156 4:157269354-157269376 TGTTTTCTTGCTCCCCAAAACGG + Intronic
983023664 4:162710110-162710132 GGGTTTCTTCCCCCCCAGAAAGG - Intergenic
983452120 4:167923828-167923850 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
983934890 4:173494740-173494762 GGATTTCTTGATTCCCAGAAGGG - Intergenic
985042462 4:185905195-185905217 GGGTTTTTTGGCCCCCAGCTTGG - Intronic
985209340 4:187575417-187575439 GGGCTTCCTAGCCCCCAGAATGG + Intergenic
986434360 5:7713810-7713832 GGCTTTCTTTCTCCCCAGAGAGG + Intronic
988870523 5:35384760-35384782 GGGTGTCTTGCCCATCAGATGGG + Intergenic
992960609 5:81954157-81954179 GGGTTTCTTGTCCCCCAGAAAGG - Intergenic
994775487 5:104032633-104032655 GGGTTTCTTGCCCCCAAGAAAGG - Intergenic
995899621 5:117051288-117051310 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1000519638 5:162280202-162280224 GGGTTTCTTGCCCACCAGAAAGG + Intergenic
1001917071 5:175570642-175570664 GGGTTTCTTGGTCCCAGGAAGGG + Intergenic
1003155926 6:3594293-3594315 GGGGTTCTTACACTCCAGAATGG - Intergenic
1004105989 6:12668106-12668128 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1004106022 6:12668227-12668249 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1004106054 6:12668348-12668370 GGGTTTCTTGCCCCCAAGAAAGG - Intergenic
1004508246 6:16263944-16263966 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
1004575011 6:16886904-16886926 GGGTTTCTTGTCCCCCAGAAAGG - Intergenic
1004768816 6:18758942-18758964 GGGTTCCTTGCCCCCCAGAAAGG + Intergenic
1009343399 6:62586906-62586928 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1013408117 6:109860620-109860642 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1014395783 6:120925761-120925783 GGGTTTCTTGCCCCCTAGAAAGG - Intergenic
1014614887 6:123587069-123587091 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
1015164994 6:130193236-130193258 GGGTTTCTTGCCCCCCAGAAAGG - Intronic
1015822557 6:137280006-137280028 GGATTTCCTGCTGCCCAGAATGG - Intergenic
1016206095 6:141470601-141470623 GGGTTTTTTCCCCTCCAAAATGG + Intergenic
1016853046 6:148640694-148640716 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1017779540 6:157705418-157705440 GGGTTTCTTGCCTCCCAGAAAGG + Intronic
1017779569 6:157705539-157705561 GGGTTTCTTGCCCCCTAGAAAGG + Intronic
1017811670 6:157988248-157988270 GGGCTTCATGCCCCCCTGCAGGG - Intronic
1018084725 6:160291364-160291386 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1018495685 6:164343824-164343846 GGGTTTCTTGCCCCACAGAAAGG + Intergenic
1018495867 6:164344941-164344963 GGGTTTATTGCCAAACAGAATGG + Intergenic
1018521705 6:164656985-164657007 GGGTTTCTTGTCCTCCAGAAAGG + Intergenic
1018521738 6:164657106-164657128 GGGTTTCTTGTCCCCCAGAAAGG + Intergenic
1018857708 6:167687337-167687359 GGGCGGCTTGGCCCCCAGAAGGG - Intergenic
1019047376 6:169159460-169159482 GGGTGTCTCTCCCACCAGAACGG + Intergenic
1019048790 6:169167798-169167820 GGGTGTCTCTCCCACCAGAACGG + Intergenic
1021650649 7:22829772-22829794 AGTGTTCTTGCCCACCAGAATGG - Intergenic
1022302115 7:29111533-29111555 GGCTTTCTTGGCCCCTAGAGAGG - Intronic
1022366889 7:29730277-29730299 GGGAATCTTGCCACCCTGAAGGG - Intergenic
1023055633 7:36287688-36287710 GGGATTCTCGCTCCCCAGGAGGG - Exonic
1024602372 7:50995105-50995127 CAGTTTCGTGCCCCACAGAAGGG - Intergenic
1028351998 7:89860121-89860143 GGGTTTTTTTCCCCCCAAAATGG - Intergenic
1028689971 7:93640869-93640891 GGGTTCCTTGCCCCCTAGAAAGG - Intronic
1029825375 7:103187182-103187204 GGGGATCTTGCCACCCTGAAGGG + Intergenic
1031134481 7:117871769-117871791 GTGTTTCTTGTTCCCCAGAAAGG - Intronic
1031364959 7:120890435-120890457 GGGTTTCTTGCCCCCTAGAAAGG + Intergenic
1032433041 7:131878522-131878544 GATCTTCTTGCCACCCAGAAAGG + Intergenic
1033742330 7:144284646-144284668 GGGCTGCATGCCCCCCATAAAGG - Intergenic
1033751572 7:144364968-144364990 GGGCTGCATGCCCCCCATAAAGG + Exonic
1033909704 7:146248275-146248297 GGGTTTCTTGCCCCCCAGAAAGG + Intronic
1037699907 8:21264620-21264642 GGTGTTCTGGCCCCCCAGAATGG + Intergenic
1041969269 8:63718541-63718563 GTGATACTTGCCCCTCAGAAGGG + Intergenic
1043718129 8:83509984-83510006 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1047674454 8:127184972-127184994 GGGTGTCATGCCCCACAGCATGG - Intergenic
1047758154 8:127934417-127934439 GGGTGTCTTCCTCCCCAGGATGG + Intergenic
1047773228 8:128047370-128047392 TGGTTTCTTGGCCACCAGAATGG + Intergenic
1048097386 8:131311090-131311112 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1049411740 8:142476674-142476696 GGGTTCCCAGCCCCCCAGACCGG + Exonic
1049869034 8:144959041-144959063 GGGTTTATTGCCCCCCAGAAAGG + Intergenic
1051705642 9:19877181-19877203 GGGTTTCTTGACTTCCAAAAGGG + Intergenic
1058853831 9:109040004-109040026 TGGTTACTTGCCACCCAGAGGGG - Intronic
1062015384 9:134288536-134288558 GGCTTTGTGGCACCCCAGAATGG + Intergenic
1185700129 X:2224446-2224468 TGGTATCTTGCCCCCTAAAACGG - Intronic
1186113105 X:6276981-6277003 GGGTTTCTTACCCCCCAGAAAGG + Intergenic
1187032133 X:15499001-15499023 GTGTTTTATGCCCCCAAGAAGGG + Intronic
1187086745 X:16049478-16049500 GTGTTTCTTGCCCCCCAGAAAGG + Intergenic
1187100085 X:16183362-16183384 GGGTGTCTTGCCCCCCAGAAAGG + Intergenic
1187100113 X:16183479-16183501 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1187154392 X:16710196-16710218 GCGTTTCTTCCTCCCCAGTATGG - Intronic
1188294879 X:28435373-28435395 GGGTTTCATGGGCCCCACAAAGG + Intergenic
1192036938 X:67573718-67573740 GGGTCTCTTGAGGCCCAGAATGG + Intronic
1193885733 X:86982811-86982833 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1194366890 X:93023895-93023917 GGGTCTCTTGCCCCCCAGAAAGG - Intergenic
1194503205 X:94703628-94703650 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1195102909 X:101573718-101573740 AGGTTTCATGCCCACCACAAAGG - Intergenic
1195841251 X:109179304-109179326 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic
1197932862 X:131712973-131712995 AGGTTTCTTGCCACCCAGAAAGG - Intergenic
1198599612 X:138269084-138269106 GGGTTTCTTGCCCCCCAGAAAGG + Intergenic
1199600348 X:149537990-149538012 GGGTTCCTTCCCCACAAGAATGG - Intergenic
1199650237 X:149941950-149941972 GGGTTCCTTCCCCACAAGAATGG + Intergenic
1200675112 Y:6140151-6140173 GGGTCTCTTGCCCCCCAGAAAGG - Intergenic
1201581173 Y:15513245-15513267 GGGTTTCTTGCCCCCCAGAAAGG - Intergenic