ID: 949670937

View in Genome Browser
Species Human (GRCh38)
Location 3:6398586-6398608
Sequence AGAGTGAATTAGAAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670937_949670945 4 Left 949670937 3:6398586-6398608 CCCAACCCCTTCTAATTCACTCT No data
Right 949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG No data
949670937_949670943 2 Left 949670937 3:6398586-6398608 CCCAACCCCTTCTAATTCACTCT No data
Right 949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG No data
949670937_949670946 8 Left 949670937 3:6398586-6398608 CCCAACCCCTTCTAATTCACTCT No data
Right 949670946 3:6398617-6398639 AGTCCCGCTTTTGTAGGGGAAGG No data
949670937_949670944 3 Left 949670937 3:6398586-6398608 CCCAACCCCTTCTAATTCACTCT No data
Right 949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG No data
949670937_949670947 9 Left 949670937 3:6398586-6398608 CCCAACCCCTTCTAATTCACTCT No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670937 Original CRISPR AGAGTGAATTAGAAGGGGTT GGG (reversed) Intergenic