ID: 949670938

View in Genome Browser
Species Human (GRCh38)
Location 3:6398587-6398609
Sequence AAGAGTGAATTAGAAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670938_949670944 2 Left 949670938 3:6398587-6398609 CCAACCCCTTCTAATTCACTCTT No data
Right 949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG No data
949670938_949670946 7 Left 949670938 3:6398587-6398609 CCAACCCCTTCTAATTCACTCTT No data
Right 949670946 3:6398617-6398639 AGTCCCGCTTTTGTAGGGGAAGG No data
949670938_949670945 3 Left 949670938 3:6398587-6398609 CCAACCCCTTCTAATTCACTCTT No data
Right 949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG No data
949670938_949670943 1 Left 949670938 3:6398587-6398609 CCAACCCCTTCTAATTCACTCTT No data
Right 949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG No data
949670938_949670947 8 Left 949670938 3:6398587-6398609 CCAACCCCTTCTAATTCACTCTT No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670938 Original CRISPR AAGAGTGAATTAGAAGGGGT TGG (reversed) Intergenic