ID: 949670940

View in Genome Browser
Species Human (GRCh38)
Location 3:6398592-6398614
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670940_949670947 3 Left 949670940 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670940_949670945 -2 Left 949670940 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
Right 949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG No data
949670940_949670943 -4 Left 949670940 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
Right 949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG No data
949670940_949670946 2 Left 949670940 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
Right 949670946 3:6398617-6398639 AGTCCCGCTTTTGTAGGGGAAGG No data
949670940_949670944 -3 Left 949670940 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
Right 949670944 3:6398612-6398634 CGGCAAGTCCCGCTTTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670940 Original CRISPR CCGCTAAGAGTGAATTAGAA GGG (reversed) Intergenic
No off target data available for this crispr