ID: 949670947

View in Genome Browser
Species Human (GRCh38)
Location 3:6398618-6398640
Sequence GTCCCGCTTTTGTAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949670937_949670947 9 Left 949670937 3:6398586-6398608 CCCAACCCCTTCTAATTCACTCT No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670940_949670947 3 Left 949670940 3:6398592-6398614 CCCTTCTAATTCACTCTTAGCGG No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670936_949670947 10 Left 949670936 3:6398585-6398607 CCCCAACCCCTTCTAATTCACTC No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670939_949670947 4 Left 949670939 3:6398591-6398613 CCCCTTCTAATTCACTCTTAGCG No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670935_949670947 11 Left 949670935 3:6398584-6398606 CCCCCAACCCCTTCTAATTCACT No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670938_949670947 8 Left 949670938 3:6398587-6398609 CCAACCCCTTCTAATTCACTCTT No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data
949670942_949670947 2 Left 949670942 3:6398593-6398615 CCTTCTAATTCACTCTTAGCGGC No data
Right 949670947 3:6398618-6398640 GTCCCGCTTTTGTAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949670947 Original CRISPR GTCCCGCTTTTGTAGGGGAA GGG Intergenic