ID: 949672716

View in Genome Browser
Species Human (GRCh38)
Location 3:6417883-6417905
Sequence TGAAAGCCAGCTCTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949672701_949672716 25 Left 949672701 3:6417835-6417857 CCAGTAGTTTTTTACTTCCCACC No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672706_949672716 8 Left 949672706 3:6417852-6417874 CCCACCCCCTCCAAGGGGGCGCT No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672710_949672716 2 Left 949672710 3:6417858-6417880 CCCTCCAAGGGGGCGCTGCCAAC No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672708_949672716 4 Left 949672708 3:6417856-6417878 CCCCCTCCAAGGGGGCGCTGCCA No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672711_949672716 1 Left 949672711 3:6417859-6417881 CCTCCAAGGGGGCGCTGCCAACC No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672707_949672716 7 Left 949672707 3:6417853-6417875 CCACCCCCTCCAAGGGGGCGCTG No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672712_949672716 -2 Left 949672712 3:6417862-6417884 CCAAGGGGGCGCTGCCAACCCTG No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data
949672709_949672716 3 Left 949672709 3:6417857-6417879 CCCCTCCAAGGGGGCGCTGCCAA No data
Right 949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949672716 Original CRISPR TGAAAGCCAGCTCTCTTGAG AGG Intergenic
No off target data available for this crispr