ID: 949676677

View in Genome Browser
Species Human (GRCh38)
Location 3:6462668-6462690
Sequence CTGTGTGTGTGTAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949676677_949676680 2 Left 949676677 3:6462668-6462690 CCATGTTCCCTACACACACACAG No data
Right 949676680 3:6462693-6462715 ATTAAACTCCATTAACAATCTGG No data
949676677_949676681 3 Left 949676677 3:6462668-6462690 CCATGTTCCCTACACACACACAG No data
Right 949676681 3:6462694-6462716 TTAAACTCCATTAACAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949676677 Original CRISPR CTGTGTGTGTGTAGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr