ID: 949681146

View in Genome Browser
Species Human (GRCh38)
Location 3:6515855-6515877
Sequence GGGTGCTGAAAAAATATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949681146_949681155 23 Left 949681146 3:6515855-6515877 CCCACTATATTTTTTCAGCACCC No data
Right 949681155 3:6515901-6515923 ATGCCCTTAACAGACATAGGAGG No data
949681146_949681154 20 Left 949681146 3:6515855-6515877 CCCACTATATTTTTTCAGCACCC No data
Right 949681154 3:6515898-6515920 TTCATGCCCTTAACAGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949681146 Original CRISPR GGGTGCTGAAAAAATATAGT GGG (reversed) Intergenic
No off target data available for this crispr