ID: 949683585

View in Genome Browser
Species Human (GRCh38)
Location 3:6542686-6542708
Sequence TCAGATCCACTAATGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949683585_949683591 17 Left 949683585 3:6542686-6542708 CCATTCTGCATTAGTGGATCTGA No data
Right 949683591 3:6542726-6542748 CACATTTCAGGCAAGCTGCAAGG No data
949683585_949683587 5 Left 949683585 3:6542686-6542708 CCATTCTGCATTAGTGGATCTGA No data
Right 949683587 3:6542714-6542736 GCCCAGAGAGTCCACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949683585 Original CRISPR TCAGATCCACTAATGCAGAA TGG (reversed) Intergenic
No off target data available for this crispr