ID: 949684365

View in Genome Browser
Species Human (GRCh38)
Location 3:6551282-6551304
Sequence TCCACTAATGAGGCCACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949684365_949684370 10 Left 949684365 3:6551282-6551304 CCCAGTGTGGCCTCATTAGTGGA No data
Right 949684370 3:6551315-6551337 ATGGAAAACATGCAAATGAAAGG No data
949684365_949684368 -9 Left 949684365 3:6551282-6551304 CCCAGTGTGGCCTCATTAGTGGA No data
Right 949684368 3:6551296-6551318 ATTAGTGGATGAAGCAGCCATGG No data
949684365_949684371 11 Left 949684365 3:6551282-6551304 CCCAGTGTGGCCTCATTAGTGGA No data
Right 949684371 3:6551316-6551338 TGGAAAACATGCAAATGAAAGGG No data
949684365_949684372 16 Left 949684365 3:6551282-6551304 CCCAGTGTGGCCTCATTAGTGGA No data
Right 949684372 3:6551321-6551343 AACATGCAAATGAAAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949684365 Original CRISPR TCCACTAATGAGGCCACACT GGG (reversed) Intergenic
No off target data available for this crispr