ID: 949689223

View in Genome Browser
Species Human (GRCh38)
Location 3:6615413-6615435
Sequence CTGTCCTCCTAGAATACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949689223_949689224 3 Left 949689223 3:6615413-6615435 CCATGAGTATTCTAGGAGGACAG No data
Right 949689224 3:6615439-6615461 ATGTCATTTGCCAACACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949689223 Original CRISPR CTGTCCTCCTAGAATACTCA TGG (reversed) Intergenic
No off target data available for this crispr