ID: 949690655

View in Genome Browser
Species Human (GRCh38)
Location 3:6633743-6633765
Sequence CTGCAAACACAGCTGTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949690651_949690655 -8 Left 949690651 3:6633728-6633750 CCTTGCCTGTGCCACCTGCAAAC No data
Right 949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949690655 Original CRISPR CTGCAAACACAGCTGTAACT AGG Intergenic
No off target data available for this crispr