ID: 949691445

View in Genome Browser
Species Human (GRCh38)
Location 3:6644495-6644517
Sequence TTTGAATGATAGGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949691443_949691445 5 Left 949691443 3:6644467-6644489 CCATTGAGGGAAGAGATGAACTA No data
Right 949691445 3:6644495-6644517 TTTGAATGATAGGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949691445 Original CRISPR TTTGAATGATAGGCTGCTGC AGG Intergenic
No off target data available for this crispr