ID: 949693871

View in Genome Browser
Species Human (GRCh38)
Location 3:6671259-6671281
Sequence CCTTATATTAATCTCATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949693871_949693880 0 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693880 3:6671282-6671304 GAGGGGCAATGGACCAGGTTGGG No data
949693871_949693882 7 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693882 3:6671289-6671311 AATGGACCAGGTTGGGCTGTGGG No data
949693871_949693885 22 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693885 3:6671304-6671326 GCTGTGGGAACTAGGATCAGAGG No data
949693871_949693879 -1 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693879 3:6671281-6671303 GGAGGGGCAATGGACCAGGTTGG No data
949693871_949693878 -5 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693878 3:6671277-6671299 TAAGGGAGGGGCAATGGACCAGG No data
949693871_949693884 14 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693884 3:6671296-6671318 CAGGTTGGGCTGTGGGAACTAGG No data
949693871_949693881 6 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693881 3:6671288-6671310 CAATGGACCAGGTTGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949693871 Original CRISPR CCTTATATTAATCTCATCTG TGG (reversed) Intergenic
No off target data available for this crispr