ID: 949693884

View in Genome Browser
Species Human (GRCh38)
Location 3:6671296-6671318
Sequence CAGGTTGGGCTGTGGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949693871_949693884 14 Left 949693871 3:6671259-6671281 CCACAGATGAGATTAATATAAGG No data
Right 949693884 3:6671296-6671318 CAGGTTGGGCTGTGGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949693884 Original CRISPR CAGGTTGGGCTGTGGGAACT AGG Intergenic
No off target data available for this crispr