ID: 949694759

View in Genome Browser
Species Human (GRCh38)
Location 3:6681456-6681478
Sequence GTCCAAAGTATGGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949694759_949694764 -7 Left 949694759 3:6681456-6681478 CCATGCCCAGCCATACTTTGGAC No data
Right 949694764 3:6681472-6681494 TTTGGACACTAGGAGTAGAAAGG No data
949694759_949694765 -6 Left 949694759 3:6681456-6681478 CCATGCCCAGCCATACTTTGGAC No data
Right 949694765 3:6681473-6681495 TTGGACACTAGGAGTAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949694759 Original CRISPR GTCCAAAGTATGGCTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr