ID: 949695282

View in Genome Browser
Species Human (GRCh38)
Location 3:6687329-6687351
Sequence CTGTTTCATCATGAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949695278_949695282 25 Left 949695278 3:6687281-6687303 CCCTTTGTTTGTGTAGCTGTGGA No data
Right 949695282 3:6687329-6687351 CTGTTTCATCATGAGCAGAGAGG No data
949695279_949695282 24 Left 949695279 3:6687282-6687304 CCTTTGTTTGTGTAGCTGTGGAT No data
Right 949695282 3:6687329-6687351 CTGTTTCATCATGAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949695282 Original CRISPR CTGTTTCATCATGAGCAGAG AGG Intergenic
No off target data available for this crispr