ID: 949697250

View in Genome Browser
Species Human (GRCh38)
Location 3:6713280-6713302
Sequence AGAGTTACTCCTGTTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949697248_949697250 1 Left 949697248 3:6713256-6713278 CCTATTCCTTAGTCGAAATAAGT No data
Right 949697250 3:6713280-6713302 AGAGTTACTCCTGTTCCTGTTGG No data
949697249_949697250 -5 Left 949697249 3:6713262-6713284 CCTTAGTCGAAATAAGTAAGAGT No data
Right 949697250 3:6713280-6713302 AGAGTTACTCCTGTTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949697250 Original CRISPR AGAGTTACTCCTGTTCCTGT TGG Intergenic
No off target data available for this crispr