ID: 949698419

View in Genome Browser
Species Human (GRCh38)
Location 3:6726893-6726915
Sequence CTGTAGAAATAGTGGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949698417_949698419 -9 Left 949698417 3:6726879-6726901 CCTCTCATAGGTTACTGTAGAAA No data
Right 949698419 3:6726893-6726915 CTGTAGAAATAGTGGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949698419 Original CRISPR CTGTAGAAATAGTGGTTGAC AGG Intergenic
No off target data available for this crispr