ID: 949707212

View in Genome Browser
Species Human (GRCh38)
Location 3:6832411-6832433
Sequence TGATAAGTATACAGCTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949707212 Original CRISPR TGATAAGTATACAGCTTATC TGG Intronic
903089396 1:20897713-20897735 TAAAAAGTAGACAGCTTATTGGG + Intronic
905845326 1:41225927-41225949 TAATAAAGACACAGCTTATCTGG + Intronic
907713121 1:56903043-56903065 TGAGAAATAGACAGCTTAGCGGG - Intronic
908524220 1:64972342-64972364 TGAAAAGCATACACCCTATCAGG - Intergenic
910443243 1:87274486-87274508 TGATCAGTTTGCAGATTATCTGG + Intergenic
911803513 1:102175325-102175347 TGATAATTACATAGCTTATATGG + Intergenic
911874499 1:103142341-103142363 TGATAAGTTTACAGTTTTGCTGG + Intergenic
912175042 1:107144367-107144389 TCATAAATATTCAGCTTTTCAGG - Intronic
916772227 1:167921624-167921646 TGGTAAAAATACAGCTCATCTGG - Intronic
916932670 1:169595257-169595279 TAATAAGTGTTCAGCATATCTGG + Intronic
921270674 1:213466625-213466647 TGCTAAATACACAGCTTTTCAGG + Intergenic
924891204 1:248282324-248282346 TGACAAGAATACAGCTAACCAGG - Intergenic
1063804452 10:9622725-9622747 TGATGAATATAAAGCTTATGGGG - Intergenic
1066605689 10:37168020-37168042 TGATAAGGAGACAACTGATCTGG - Intronic
1066606472 10:37179812-37179834 TGATAAGGAGACAACTGATCTGG - Intronic
1070985076 10:80681723-80681745 TGATAAGTATACTCTTTATTTGG + Intergenic
1074951130 10:118337735-118337757 GGATAATTATACTGCTTATAGGG + Intronic
1076193111 10:128496745-128496767 TGATAAATGTACAGATTAGCAGG - Intergenic
1085977834 11:81681419-81681441 TGATAAGTATACAGATAAATTGG - Intergenic
1087465616 11:98500943-98500965 TGAAATGTTTACAGCTTTTCAGG - Intergenic
1087513418 11:99127619-99127641 TGATGTGGATACAGCTTATCAGG - Intronic
1094260853 12:28497402-28497424 TAATAAGTATACAGGTTTTTTGG + Intronic
1095259963 12:40086314-40086336 TGAAAAGTATTCAGATTAACCGG - Intronic
1095372389 12:41484702-41484724 TGTTAAGTTTACAGCAAATCTGG - Intronic
1098682906 12:73380630-73380652 TGATAAGAATACATTTTCTCTGG + Intergenic
1112702310 13:102024403-102024425 TGGTAATTATACAACTTTTCTGG + Intronic
1114568579 14:23649876-23649898 TGATGAGTTTACAGCTCTTCAGG + Intergenic
1116423997 14:44767288-44767310 TGTTAAGAATACACTTTATCAGG + Intergenic
1119588217 14:75858652-75858674 TGATAAAATTACAGCTTTTCAGG + Intronic
1120303342 14:82735935-82735957 TGGAAAATATACACCTTATCAGG - Intergenic
1125355135 15:38809576-38809598 TGATAGGTACACAGCTCAGCTGG + Intergenic
1125571837 15:40726172-40726194 TGTTAAATATACAGATTACCAGG + Intronic
1126591013 15:50339554-50339576 TGATAAATATATAGCTTAGGTGG - Intronic
1127678219 15:61265655-61265677 TGATAAGTATGCTATTTATCAGG - Intergenic
1128955367 15:71936593-71936615 TAATAATTATACATATTATCAGG - Intronic
1134119966 16:11576819-11576841 TGATAAATATATACCTTATTTGG + Intronic
1137343627 16:47634841-47634863 TGATAACAAAACTGCTTATCAGG - Intronic
1140134839 16:72196939-72196961 TTATAAGCATACAGATTCTCAGG + Intergenic
1150627801 17:66853805-66853827 TGTTGAAAATACAGCTTATCAGG - Intronic
1151116716 17:71743712-71743734 TGAAAAATATACAGCGTTTCAGG - Intergenic
1155456718 18:26024267-26024289 TAATAGGTATACAGTTTATCAGG + Intronic
1158003961 18:52650632-52650654 TGATAAATAAACAGGTTGTCTGG + Intronic
1163896036 19:20060056-20060078 TGAAAAGTACACAGTTTATTTGG + Intergenic
1163900769 19:20098067-20098089 ATATAAGTAGACAGCTTATTTGG - Intronic
1165588261 19:36941417-36941439 TAAAAAGTATAAAGCTGATCAGG - Intronic
929208646 2:39327930-39327952 TGATAAGCACACAACTTAGCTGG - Intronic
930623416 2:53668304-53668326 TAATAAGTAGACAGTTTATTTGG - Intronic
930780011 2:55215527-55215549 TGATGGGTATGCAGTTTATCTGG - Intronic
936507897 2:113122692-113122714 AGATAAGTTTCCAGCTCATCGGG + Intronic
940311460 2:152283283-152283305 TGATAATTATACGGATTATAAGG - Intergenic
943612701 2:190052260-190052282 TGAAAAGTATGCAGCTTTTCAGG + Intronic
945410318 2:209499193-209499215 TGGTGACTATACAGCATATCTGG - Intronic
948527751 2:238582673-238582695 TGATAAGTTTTCAGCTCATCTGG + Intergenic
1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG + Intergenic
1171032533 20:21690624-21690646 TGAAAGGTATACAGCTTCTCAGG + Intergenic
1173077015 20:39828915-39828937 TGATAAGTCTACAGTATACCTGG + Intergenic
1177548109 21:22585253-22585275 TGATAATTATACAGCATAAGGGG + Intergenic
1181945039 22:26509963-26509985 TGATAAGTATACTTCTCACCTGG - Intronic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
949921097 3:9001277-9001299 TGATGAATATACTGCTTACCCGG + Intronic
957327143 3:78710939-78710961 TGTTAAGTATACAGATTATCAGG - Intronic
957363207 3:79185917-79185939 TGAAAAGTATTTAGCATATCTGG - Intronic
963099389 3:141584554-141584576 TGAAGAGTAAACAGATTATCTGG - Intronic
971215654 4:24660094-24660116 CAATAAGTATACTGCTTATGAGG + Intergenic
971608473 4:28689051-28689073 AGATAAGTATACAGCACATACGG + Intergenic
971847104 4:31933043-31933065 TTATTAGTATACAGCTTCTCTGG - Intergenic
972181012 4:36465859-36465881 TGAAAAGTATACAGTGTATATGG - Intergenic
972905861 4:43746187-43746209 TAAAAAGTATAAAGTTTATCTGG - Intergenic
975631738 4:76410939-76410961 TAAAAAGTATACAGCTTAAAAGG + Intronic
977142618 4:93393127-93393149 TGTTTAGGATACAGATTATCTGG - Intronic
977587549 4:98790752-98790774 TTACAAGTCTACAGGTTATCTGG - Intergenic
981980237 4:150783029-150783051 TGTTAAGTATAAAGCCTATCAGG + Intronic
984454634 4:179949285-179949307 TGAAACGTATACAGATTAACAGG + Intergenic
987432970 5:17859361-17859383 TGATATATCTACTGCTTATCTGG + Intergenic
987548189 5:19341140-19341162 TGAAAAGTATGGAGCCTATCAGG - Intergenic
993146682 5:84102647-84102669 TCCTAGGAATACAGCTTATCAGG + Intronic
994704045 5:103177548-103177570 TGATAAGTATTCACTTTATGTGG + Intronic
999049608 5:148508187-148508209 TGATTAGTATTCAGCTGTTCTGG - Intronic
999328494 5:150657704-150657726 TGATAAAAATAGAGCTTGTCTGG - Intronic
999911061 5:156199854-156199876 TTTTAAATATACAGCTTCTCTGG - Intronic
1005023783 6:21443216-21443238 TGATAAGTAAACATATTATGCGG + Intergenic
1005220468 6:23582201-23582223 TGATAAGTAGAGATATTATCTGG - Intergenic
1005386639 6:25291841-25291863 TGATATGTGTACTGCTTAACTGG - Intronic
1012866460 6:104624257-104624279 CGATGAATATACAGCTTATTTGG + Intergenic
1014905525 6:127022288-127022310 TGATAAGTAGATTGCTTATATGG - Intergenic
1016203520 6:141443202-141443224 TGATAAGAAAACAGTTTAACAGG + Intergenic
1017190953 6:151652013-151652035 TGATAATCATAAAGCTTGTCTGG + Intergenic
1021226165 7:18028973-18028995 TTTTAAGTATACAGCTTCTATGG + Intergenic
1022009518 7:26296619-26296641 TGATAATAATAAAGCTTACCTGG + Intronic
1022864416 7:34402218-34402240 TGGAAAGCAAACAGCTTATCTGG - Intergenic
1026132267 7:67630333-67630355 TGATCAGTAGACAGGGTATCTGG + Intergenic
1027258348 7:76445576-76445598 TGATAAGTAAACAGATTGTCAGG - Intergenic
1027280502 7:76606442-76606464 TGATAAGTAAACAGATTGTCAGG + Intergenic
1028030954 7:85911881-85911903 AGCTAAGAATACAGCTGATCAGG + Intergenic
1028320392 7:89452314-89452336 TGTTAAGTTTACAGTTTCTCAGG - Intergenic
1029211374 7:98910984-98911006 TTTTAAGTATGCAGCTGATCTGG + Intronic
1029888801 7:103904829-103904851 TGATAAGTCTACAGTTTCTTGGG - Intronic
1035411314 7:158644827-158644849 TGATAAGAATACTCCTTAACTGG - Intronic
1036731373 8:11268630-11268652 TGATAATTATACAGCATTTTCGG + Intergenic
1040604028 8:48912014-48912036 TGAAAAGTATAAGGCTTTTCTGG - Intergenic
1041697107 8:60747599-60747621 GGACAAGTTTACAGCTTATTTGG + Intronic
1045480743 8:102590063-102590085 TGATTAGTAGGCAGCTTTTCTGG - Intergenic
1046706838 8:117463515-117463537 ATATATGTATATAGCTTATCAGG - Intergenic
1047014166 8:120704910-120704932 TGATAAGAATACAGATTCTAGGG + Intronic
1051073776 9:13206206-13206228 GAATAAGTATTCACCTTATCAGG + Intronic
1056615994 9:88166323-88166345 TGATAAGGAAACAGCTTTTCTGG + Intergenic
1060637956 9:125214333-125214355 GGATATATATACAGCATATCTGG - Intronic
1186738897 X:12496417-12496439 TGTTAAATATACAGATTACCAGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1191001750 X:55667129-55667151 TCATAGGAATACAGCTAATCAGG + Intergenic
1191652542 X:63556452-63556474 TGCAATGTATAGAGCTTATCTGG - Intergenic
1192847249 X:74919114-74919136 TAATAAGTTTAAAGTTTATCAGG - Intronic
1194686363 X:96922729-96922751 TTAAAAGTCTACAGCATATCTGG - Intronic
1196259752 X:113564611-113564633 TAATAAGTATGCAGATTAACTGG - Intergenic
1199142845 X:144332902-144332924 TGACAATTCTACTGCTTATCTGG - Intergenic
1201512731 Y:14783089-14783111 TGTTAAGTATTAAGCTTATTAGG - Intronic