ID: 949707766

View in Genome Browser
Species Human (GRCh38)
Location 3:6838609-6838631
Sequence GCAGATTTATTAGAAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949707766_949707768 2 Left 949707766 3:6838609-6838631 CCTGTCTTTTCTAATAAATCTGC 0: 1
1: 0
2: 2
3: 30
4: 333
Right 949707768 3:6838634-6838656 TTCTTCGCCCATGACTGTCTTGG 0: 1
1: 0
2: 10
3: 18
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949707766 Original CRISPR GCAGATTTATTAGAAAAGAC AGG (reversed) Intronic
900838110 1:5022116-5022138 GCAGATTTATTAGAGAAAGTAGG + Intergenic
903086020 1:20859762-20859784 GCAAATTTTTTAGTAGAGACGGG + Intronic
906850003 1:49237870-49237892 GCAGACTTATTCTAAAAGAATGG - Intronic
907229717 1:52985012-52985034 GCATATTTTTTAGTAGAGACGGG + Intronic
907627510 1:56044538-56044560 GCAGATTTATTGCAAGAGACTGG + Intergenic
908290297 1:62659031-62659053 GCAGATCTATTCTAAAAGAATGG + Intronic
908822007 1:68097722-68097744 GCAAATTAAATAAAAAAGACAGG - Intergenic
910988821 1:93033604-93033626 ACAGATTTAGTAACAAAGACTGG - Intergenic
916303062 1:163297135-163297157 GCAGATTTATTAGAGAAGGTAGG + Intronic
917544421 1:175948629-175948651 GCAGCTTTATTAGAAATGAAAGG - Intronic
917636609 1:176943261-176943283 ACAGATTAATTAGAAGAGGCAGG - Intronic
918468222 1:184843400-184843422 CCATACTTTTTAGAAAAGACTGG - Intronic
919110476 1:193213010-193213032 GCATGTTTATTAGAACAAACTGG - Intronic
919971223 1:202580569-202580591 CCAGATTTATGAGGAAAGAAAGG + Exonic
920862668 1:209723368-209723390 GCACATTTTTTAAAAAAAACTGG + Intronic
920919063 1:210283106-210283128 GCAGATTTATTAGAGAAAGTAGG + Intergenic
921795346 1:219337119-219337141 CGAGATTTCTTAGAAAAGAGAGG - Intergenic
922865393 1:228856534-228856556 GCAGAATAAATAGAAAACACAGG - Intergenic
923059389 1:230456502-230456524 GCAGATTTATTAGAGAAAGTAGG - Intergenic
924069098 1:240257070-240257092 GCAGATTTAAAACAAAACACTGG + Intronic
924251466 1:242137364-242137386 GCAGATTTATTAGAGAAAGTAGG - Intronic
924554233 1:245104833-245104855 GCATATTTATGAGACAAGAGCGG - Intronic
924572437 1:245249270-245249292 GTATATTTTTTAGAAGAGACAGG + Intronic
1062899868 10:1135352-1135374 GCATGTTTATTATAAAAGGCAGG - Intergenic
1063963326 10:11325283-11325305 TCATCTTTATTAGAAATGACTGG - Intronic
1065562902 10:26981231-26981253 GCAGATTTATTAGACAAAGTAGG + Intergenic
1065630583 10:27676780-27676802 GCATATTTATTAGAAGAAGCAGG + Intronic
1067369921 10:45673192-45673214 GCAGATTTGTTAGGACAGGCCGG - Intergenic
1067851053 10:49754461-49754483 GCAGATTGTGTAGGAAAGACAGG - Intronic
1069028413 10:63569456-63569478 GCAGATTTGGGAGAAAAGATTGG - Intronic
1069655565 10:70085320-70085342 GCAGATTCAGTAGTACAGACGGG + Intronic
1070492637 10:76992126-76992148 TCAGATTTACTAGAAAAGGCTGG + Intronic
1070553653 10:77511834-77511856 GCAGATTTATTAGAGAAAGTGGG + Intronic
1071422527 10:85514903-85514925 GTAAATTTATTAGAATTGACGGG - Intergenic
1071840172 10:89462316-89462338 GCAGATTTAAAAGAAAAGACAGG + Intronic
1072246970 10:93552512-93552534 GCAGGTTCATAAGAAAAGTCAGG - Intergenic
1072833367 10:98683623-98683645 GGAGGTTTATCAGAAAAGAGAGG + Intronic
1073374562 10:103021815-103021837 GCAAATTTTTGAGAAAATACTGG + Intronic
1073506389 10:103996367-103996389 AAATATTTATTAGAAAAGACTGG - Intronic
1075607365 10:123821987-123822009 GAATAATTATTAGATAAGACAGG + Intronic
1075627170 10:123971927-123971949 AGAGTTTTATTTGAAAAGACAGG + Intergenic
1077258526 11:1602042-1602064 GCAGATTTATTAGAGAATGTAGG - Intergenic
1077804483 11:5576585-5576607 AAAGATATATTAGAAAAGATAGG + Intronic
1079353270 11:19711448-19711470 GCACTCTTATTAGAAGAGACAGG - Intronic
1080564025 11:33491669-33491691 TCAGATTTCTTAGAGAAAACAGG - Intergenic
1081655081 11:44851652-44851674 GCAGATGTATGAGAAGAGAGAGG - Intronic
1081665319 11:44913685-44913707 GCAGATGGGTTAGAAAAGCCTGG + Intronic
1082936226 11:58659744-58659766 GCATTTTTCTAAGAAAAGACTGG - Intronic
1084802999 11:71557945-71557967 GCAGATTTATTAGAGAATGTAGG + Intronic
1086320856 11:85646363-85646385 GCTTATTTTTTAGTAAAGACAGG - Intergenic
1086415242 11:86582587-86582609 GCTGACTTATTAGTAAAGATAGG + Intronic
1087040214 11:93791820-93791842 GCAGATTAATGGGAAAAGAAAGG - Intronic
1087204695 11:95381712-95381734 CCATATTAAATAGAAAAGACTGG - Intergenic
1087367551 11:97240038-97240060 AGAGATTTATTAAAAAAAACTGG + Intergenic
1087443435 11:98215640-98215662 ACAGATATATTAAAAAATACTGG - Intergenic
1087947023 11:104175093-104175115 GCATTTTTATTAGAAAAGAGGGG - Intergenic
1092917801 12:13203844-13203866 GCAGATTTATTATAAGAATCTGG + Intronic
1093762903 12:22930146-22930168 GCAGATTTATTAGAGAAAGTAGG + Intergenic
1093865533 12:24222532-24222554 GCAGATTTAATGGAAAAAGCAGG + Intergenic
1094020820 12:25912240-25912262 ACAAATTTATAAGAAAAGGCTGG - Intergenic
1095638483 12:44458859-44458881 TCAGATTCATTGGAAAGGACTGG + Intergenic
1097494210 12:60309699-60309721 GCAGCTTTAATAGATAATACAGG + Intergenic
1097568537 12:61301225-61301247 GCACATTCATTTGAAAAGAGAGG - Intergenic
1097829470 12:64208372-64208394 GCAGATGAATTTGAAAAGATAGG + Intronic
1097830589 12:64220937-64220959 GCTAATTTATTAGCAAAAACTGG - Intronic
1098536191 12:71595995-71596017 GCACACTTGTTAGAAATGACAGG + Intergenic
1099508066 12:83503156-83503178 GGACATTTATTGGAAAAGAATGG + Intergenic
1100020404 12:90062500-90062522 GCTAATTTATTAGTAGAGACAGG - Intergenic
1101158793 12:101953042-101953064 GCAGATGAATTAGAAAAAAATGG + Intronic
1101322716 12:103687298-103687320 ACAGAGTTATTAAAAAAGACTGG - Intronic
1101468128 12:104968772-104968794 ACAGATTGATGAGAGAAGACTGG + Intergenic
1103473004 12:121196919-121196941 CCAGATCTGTTAGAAAAGAAGGG + Intergenic
1103473242 12:121198942-121198964 ACAGATCTGTTAGAAAAGAAGGG - Intergenic
1104055724 12:125228526-125228548 CCAGATTGATTGGAAAACACAGG + Intronic
1104140216 12:125980834-125980856 GCAGATTTTATAGAAAGGGCTGG - Intergenic
1105040972 12:132961034-132961056 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1105698293 13:22912266-22912288 TCAAATTTATTAGAAAAAAATGG - Intergenic
1105707212 13:22975535-22975557 GCAGACTTATTAGAGAAAATAGG - Intergenic
1105849952 13:24324510-24324532 TCAAATTTATTAGAAAAAAATGG - Intergenic
1106754956 13:32813454-32813476 GTGGATTTATTAGTAAAGCCAGG - Intergenic
1109179527 13:59197508-59197530 AGAGATTTATTATGAAAGACTGG - Intergenic
1110248847 13:73358482-73358504 ACAGATTTGATAGAAAGGACTGG - Intergenic
1110361214 13:74627604-74627626 GCAAATTTATTAGTAGAAACAGG + Intergenic
1110401631 13:75098557-75098579 GCAGGTCTATTAGAAAAAAGTGG - Intergenic
1110660795 13:78057638-78057660 GCACATTTATATGAAAAGAAAGG - Intergenic
1110851295 13:80248067-80248089 GCTGATATATAAGACAAGACTGG + Intergenic
1110983089 13:81928008-81928030 GCAGATTTATTAGATAAAGTAGG - Intergenic
1110995620 13:82104403-82104425 GTATATTTATGAGAAAAAACTGG - Intergenic
1111526808 13:89482511-89482533 GGAGTTATATTAGAAGAGACAGG - Intergenic
1114968229 14:27991885-27991907 GCACATATCTTATAAAAGACAGG - Intergenic
1115619166 14:35123630-35123652 GAAGATTTAAAAGAAAACACCGG + Exonic
1116791404 14:49343895-49343917 GGAGCTTTATTGGAAGAGACTGG + Intergenic
1116966419 14:51020206-51020228 TCAGATTTGTGAGAAAAGACTGG - Intronic
1117166580 14:53040244-53040266 ACTTATATATTAGAAAAGACAGG - Intronic
1117581880 14:57159372-57159394 GCAGTATTATTAGATAACACAGG + Intergenic
1119308905 14:73630420-73630442 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1119876603 14:78065206-78065228 GCAGAATGATTTGAAAAGAGGGG + Intergenic
1120086151 14:80275896-80275918 GCATAATTATTAGAAAATAGGGG + Intronic
1121057371 14:90869373-90869395 GCAGAGTAATTAGAAGAAACTGG + Exonic
1121128523 14:91424941-91424963 GCAGATTTATTAGAGAAACTAGG + Intergenic
1121474952 14:94190434-94190456 GCTAATTTTTTAGTAAAGACAGG - Intronic
1122638548 14:103142757-103142779 GCAGGCTTATTAGAGAACACAGG - Intergenic
1122839904 14:104452488-104452510 TCAAATTTATTAGAAAAAAGTGG - Intergenic
1122851149 14:104532024-104532046 GCAGATTTATTAGAGAAAATAGG - Intronic
1123820257 15:24022552-24022574 GCAGATTTATTAGAGAAAGTAGG + Intergenic
1123887904 15:24746004-24746026 TCACTTTTATTAGGAAAGACAGG + Intergenic
1124684508 15:31769987-31770009 GTAACTATATTAGAAAAGACAGG + Intronic
1128678395 15:69628488-69628510 GCAGATTTATTTGAAGATACGGG + Intergenic
1129321785 15:74779165-74779187 GCAGATTTATTAGAAAAAGTAGG + Intergenic
1130782199 15:87052569-87052591 ACAGATTTATTACAGAAGATGGG + Intergenic
1131594035 15:93778742-93778764 GCATATTTATAACAAAAGACTGG - Intergenic
1133654089 16:7842857-7842879 GTAGATTTGTTAGAAAAAAATGG - Intergenic
1134210534 16:12272697-12272719 TTAGCTTTATTACAAAAGACAGG + Intronic
1135132003 16:19860863-19860885 GCATATTTATTATAACACACAGG + Intronic
1136282174 16:29220403-29220425 GCTGATTTATAAGGAAAGAGGGG - Intergenic
1138396451 16:56708466-56708488 GTAGATTTATTAGAGAAAAGCGG + Intronic
1138705449 16:58910628-58910650 GCAGATTTATTAGAGAAAGTAGG + Intergenic
1138771209 16:59665966-59665988 GCAGATTCATTAGCTCAGACAGG + Intergenic
1139374702 16:66489652-66489674 GCAGATTTATTAGAGAAGGTAGG + Intronic
1140333355 16:74079854-74079876 GGAGATTGATTATAAAAGAATGG + Intergenic
1141021876 16:80504900-80504922 GCAGTTTACTTAGAAAACACTGG - Intergenic
1141044078 16:80700030-80700052 GCTGATTTTTTAGTAGAGACGGG + Intronic
1141295984 16:82769765-82769787 GCTGATGCATTAGAAAAGCCAGG - Intronic
1141318005 16:82979849-82979871 GCACAGTCATTAGAAAAAACTGG + Intronic
1142086545 16:88186322-88186344 GCTGATTTATAAGGAAAGAGGGG - Intergenic
1142636389 17:1260250-1260272 GGAGATTTATGAGCTAAGACCGG - Intergenic
1144181412 17:12755965-12755987 ACAGATTGATTAGAAAGGGCTGG + Intronic
1144181533 17:12756799-12756821 ACAGATTGATTAGAAAGGGCTGG + Intronic
1144420808 17:15096723-15096745 TCAGCTTAATTAGACAAGACAGG - Intergenic
1148519611 17:48259838-48259860 TCAGCTTTATTTGAAAAGCCAGG + Intronic
1149199011 17:54160843-54160865 GCAGATTCATTAGAGAAAAGGGG - Intergenic
1149414796 17:56448035-56448057 ACAGATTTATTTTAAAATACGGG - Intronic
1149887198 17:60351800-60351822 CAAAATTTAGTAGAAAAGACAGG + Intronic
1152915006 17:83029920-83029942 GCAGATTTATTCGAGAAAGCAGG - Intronic
1154198633 18:12284131-12284153 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1155522428 18:26682373-26682395 GCAAATTTATCAGAGAATACGGG + Intergenic
1156013091 18:32516374-32516396 GCAGATTTATTAGAGAAAGTAGG + Intergenic
1156082770 18:33358524-33358546 GCTGATTTATAAGAAATGACTGG + Intronic
1156613077 18:38750667-38750689 ACAGATTTATAATAAAAGATAGG - Intergenic
1157757434 18:50231272-50231294 GCAGATTTATTAGAGAAAGTAGG - Intronic
1157969751 18:52252982-52253004 GCAGATTTGTTAGGATAGACTGG - Intergenic
1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG + Intronic
1158542659 18:58370770-58370792 GCAGTTTTTATAGAAAACACAGG - Intronic
1158822191 18:61173550-61173572 TCACATTAATTAGAAAAGAGAGG - Intergenic
1158882940 18:61798558-61798580 CCAAATTTGTGAGAAAAGACTGG + Intergenic
1158924578 18:62241209-62241231 GCAGATTTATTAGACAAAGTAGG - Intronic
1158980184 18:62752485-62752507 GCATATCTATTTGAAAAGACTGG - Intronic
1159344309 18:67179457-67179479 GCACATTTAATAGAAAAAATGGG - Intergenic
1159938405 18:74386954-74386976 GCAGGTTTATTAGAAAAAGTAGG - Intergenic
1164285765 19:23815432-23815454 GCAGGTTTATTAGAAGAACCTGG + Intronic
1164297696 19:23928085-23928107 GCAGGTTTATTAGAAGAACCTGG + Intronic
1164691790 19:30216512-30216534 GAAGAATAATTAGAAAACACAGG - Intergenic
1165281916 19:34805056-34805078 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1166589593 19:43984939-43984961 GCAGCTCTTTTAGAAAAGTCAGG - Intronic
1166596824 19:44057888-44057910 GCAGATTTATTACTACAGATTGG + Intronic
1166907422 19:46121695-46121717 GCAGATTTTTTAGAAAATGTAGG + Intronic
1168032160 19:53689060-53689082 GCAGATTAAATTAAAAAGACAGG - Intergenic
925282637 2:2695444-2695466 GCAGATTTAGTGGCAAAGACGGG + Intergenic
925706867 2:6693753-6693775 GCAGAGTTACTAGAATAGATTGG - Intergenic
926098716 2:10099659-10099681 GCATAGTTATTAGTAAAGAAAGG + Intergenic
926481744 2:13406635-13406657 GCAGATTTATGAGAAAAATAAGG + Intergenic
926922077 2:17948985-17949007 GAAGATTTAGTAGAAAACACAGG + Intronic
929353629 2:40992366-40992388 GCAGCTCTAATTGAAAAGACAGG - Intergenic
930557119 2:52911802-52911824 ACAAATTTGTTAGAAAATACAGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932782285 2:74567821-74567843 ACATATTTTTCAGAAAAGACTGG + Intronic
934579230 2:95425253-95425275 GCAGAGTTATTAGCAGACACTGG - Intergenic
934600216 2:95651471-95651493 GCAGAGTTATTAGCAGACACTGG + Intergenic
936533565 2:113293467-113293489 GCAGAGTTATTAGCAGACACTGG + Intergenic
936777186 2:115987914-115987936 ACAAATTTATTAGAAACCACAGG + Intergenic
937067310 2:119027252-119027274 GCAGATTTGCTAAAAGAGACTGG - Intergenic
937101708 2:119276289-119276311 GCAGATTTATTAGAGAAAGTAGG - Intergenic
938384664 2:130855734-130855756 GCACATTTCATAGAAAACACTGG - Intronic
939824403 2:146997653-146997675 GCAGTTTTATGAGAATAGAGTGG - Intergenic
940216103 2:151305146-151305168 TCAGATTTATAGGAAAAGAGAGG + Intergenic
940585066 2:155637329-155637351 GCAGAGTTATTCTAAAAGAGTGG - Intergenic
941415088 2:165210400-165210422 GGAGTTTCATCAGAAAAGACAGG + Intergenic
942169107 2:173272103-173272125 GGAGATTTATTACAATAGAGGGG - Intergenic
942712621 2:178853935-178853957 GCAGACTTATAAGAACAGGCAGG + Intronic
942902053 2:181132640-181132662 ACAGATTAGTCAGAAAAGACAGG - Intergenic
945469475 2:210210971-210210993 GCAGGTTTGTTAGAAAAAAATGG - Intronic
946337813 2:219050004-219050026 GCAGAGTGATTAGACAGGACTGG - Intergenic
947892829 2:233641183-233641205 GCAGATTTATTAGAGAAAGTAGG - Intronic
948187448 2:236032580-236032602 GAAGCATTATTAGAAAAGAGAGG + Intronic
948593467 2:239065399-239065421 GGAGATTTTTTTGTAAAGACAGG + Intronic
1168930321 20:1618285-1618307 GCAGAAATATTAGAAAATGCAGG - Intronic
1169409819 20:5358644-5358666 GCAAATTGATAAGAAAACACTGG + Intergenic
1169749626 20:8978504-8978526 GCACATTTGTTAAAGAAGACTGG + Intergenic
1169865462 20:10195275-10195297 TCAAATCTAGTAGAAAAGACAGG - Intergenic
1172737061 20:37134802-37134824 GCAGATTTATTAGAGAAAGTAGG - Intronic
1172857039 20:38012966-38012988 GCAGATTGGGTAAAAAAGACTGG - Exonic
1173381540 20:42548753-42548775 GAAAATTTAATAGAAAACACAGG + Intronic
1175024382 20:55886242-55886264 CAACATTGATTAGAAAAGACCGG + Intergenic
1175538805 20:59735408-59735430 GCTGATTTCTTAGAGAAGAAAGG - Intronic
1177381974 21:20355706-20355728 GTATATTTTTTAGAAAAGATTGG - Intergenic
1177752707 21:25305474-25305496 GAAGATATATTAGAACAGCCAGG - Intergenic
1178514912 21:33238278-33238300 GCAGATTTATTAGAGAAAGTAGG - Intronic
1178994519 21:37386587-37386609 GCACATTGTTTAGAATAGACAGG - Intronic
1180978238 22:19863167-19863189 GCTAATTTTTTAGTAAAGACGGG + Intergenic
1181392177 22:22591387-22591409 GCATATTTAATAGGAAAAACAGG - Intergenic
1182131407 22:27855474-27855496 ACAGATGTATTAGAAAGGACAGG + Intronic
949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG + Intronic
949707766 3:6838609-6838631 GCAGATTTATTAGAAAAGACAGG - Intronic
951337563 3:21443228-21443250 GCAGATTTGTAAGAACAGAGCGG - Intronic
952166625 3:30756843-30756865 CCAGATTCATTAGGAAAGATAGG + Intronic
952219555 3:31311623-31311645 GCACATTTATTAGAGAAGTAAGG + Intergenic
952232966 3:31450770-31450792 TTAGATTTAAAAGAAAAGACAGG + Intergenic
955156309 3:56420347-56420369 GCTAATTTTTTAGTAAAGACAGG + Intronic
955452717 3:59087251-59087273 CCATATTCAATAGAAAAGACTGG - Intergenic
955683896 3:61530443-61530465 GCAGAATTATCAGAAAAAGCTGG + Intergenic
956526214 3:70165239-70165261 GCAGACTTATCAGATAACACAGG + Intergenic
957173444 3:76771065-76771087 GCAGTTTTCTTTTAAAAGACAGG + Intronic
957455580 3:80439049-80439071 GAAGATTTATTATAAAGAACTGG - Intergenic
957840730 3:85665826-85665848 TAAGATTTATTTGAAAAGATTGG - Intronic
958120182 3:89276559-89276581 GCATATATATTAAAAAACACAGG + Intronic
958705988 3:97655996-97656018 GTAGAATAATTTGAAAAGACTGG - Intronic
959627088 3:108464837-108464859 GCAGATTTCTTTAAAAACACCGG + Intronic
960932678 3:122869870-122869892 TCAGATGTATCAGAAGAGACTGG + Intronic
961722178 3:128904029-128904051 GCAGAGTTATTAGAATGAACTGG - Intronic
962020096 3:131490991-131491013 GAAGATTTCTTAGAAGAGAGTGG - Intronic
962455573 3:135562550-135562572 GCAGATTTCAGAGAAAAGACAGG - Intergenic
963236321 3:142960907-142960929 GCAGTTTTATTATGAAAGGCAGG - Intronic
963358484 3:144239994-144240016 GCAGATTAATTGGAAAAAAAAGG - Intergenic
963394026 3:144708720-144708742 GGAGACTTACTAGAAAACACAGG - Intergenic
963418891 3:145033843-145033865 GCAGATGTATTAGTACAGAAGGG + Intergenic
966014262 3:175121869-175121891 GGAGATTTTATATAAAAGACAGG + Intronic
966623311 3:181989228-181989250 GGATATTTCTTAGAGAAGACTGG + Intergenic
966938548 3:184730583-184730605 TCAGATTTAGTACAAATGACTGG + Intergenic
967459784 3:189732271-189732293 GGGGCTTTATTACAAAAGACAGG - Intronic
967697509 3:192549982-192550004 GGAGATTTATTATAAGAGATTGG - Intronic
967935725 3:194725936-194725958 GCAGATTCTCTATAAAAGACTGG + Intergenic
968888552 4:3352771-3352793 CAAGACTTATTACAAAAGACTGG - Intronic
969888677 4:10239666-10239688 GCAGACTGACTAGCAAAGACTGG + Intergenic
971099826 4:23453057-23453079 GCAGGTTTATGAGAAAGGAGGGG - Intergenic
973102646 4:46292413-46292435 GGACATTAATTAGAAAAGAATGG + Intronic
973572221 4:52252299-52252321 TCAGATTTATTATCAAAGAAAGG + Intergenic
974159593 4:58120592-58120614 GAAGGTTTATTAGAAAAAATTGG - Intergenic
974252562 4:59405607-59405629 GCTGATTTTTTAGTAGAGACGGG + Intergenic
975067131 4:70080094-70080116 TCATATTTATTTGAAAAGAAAGG - Intergenic
975174864 4:71276742-71276764 GCAGCTTTATTTCAAAAGCCTGG - Intronic
975412643 4:74072075-74072097 GCAGAAGTCTAAGAAAAGACAGG + Intergenic
975583698 4:75929567-75929589 GTATATTTATTAAAAATGACTGG - Intronic
977147907 4:93469133-93469155 GAAGATTTATCAGAAAAGAATGG - Intronic
978804912 4:112789681-112789703 ACAGATTTACTAGAATATACAGG - Intergenic
979119076 4:116870727-116870749 GCAGATTTATTAGTAAAAAGGGG + Intergenic
979570963 4:122224153-122224175 TTAGATTTCTTACAAAAGACTGG + Intronic
980564747 4:134524975-134524997 GAAGATTTATAAGCAGAGACAGG + Intergenic
980596291 4:134959545-134959567 GCAGCTTTATTAAATAAGATTGG + Intergenic
981141350 4:141272984-141273006 GGAAATATATTAGAAAAGCCTGG - Intergenic
981383679 4:144102204-144102226 GCAAATTGATTAGAAATCACAGG + Intergenic
981664719 4:147210993-147211015 TAGGATTTATTAGAAAAGAAAGG - Intergenic
981666409 4:147231839-147231861 GCAGATATACCAGGAAAGACAGG + Intergenic
982871742 4:160587833-160587855 TCATATTTATTAGAATAGAGTGG + Intergenic
983790674 4:171793750-171793772 GCAGATTTATTAGAGAAAGTAGG - Intergenic
984726940 4:183030660-183030682 GCAGATTTATTGGAAAAAGTAGG + Intergenic
985347406 4:189020751-189020773 GCATATTCATTACAAAAGACTGG - Intergenic
985863604 5:2494165-2494187 GAAGATTTATGATAAAAGAATGG - Intergenic
987562066 5:19537337-19537359 GTAGATTTATTATAAAAAATTGG - Intronic
988245326 5:28673435-28673457 TCAGATTTCTGAGAAAGGACTGG - Intergenic
988295541 5:29355375-29355397 GCAAGTTTATTAGAAAATATAGG - Intergenic
988432972 5:31141380-31141402 GTATTTTTTTTAGAAAAGACAGG + Intergenic
988685708 5:33523329-33523351 GCACATTCATGAGAAGAGACCGG + Intergenic
989133361 5:38129117-38129139 GCAGATTCTACAGAAAAGACGGG - Intergenic
989318833 5:40111680-40111702 GCACATTTATAAAAAAAGAAAGG + Intergenic
990108228 5:52291029-52291051 GCTGTTTTATTAGAAGGGACAGG + Intergenic
990171550 5:53056095-53056117 GCAGCTCTACTAGAAAAGGCTGG + Exonic
991234926 5:64382735-64382757 GTAGATCTTTGAGAAAAGACAGG + Intergenic
993344089 5:86760963-86760985 GCAGATTTATTAGACAAAGTAGG - Intergenic
993474345 5:88345930-88345952 GCAGACTGACTAGAAATGACAGG - Intergenic
993736503 5:91482939-91482961 GCAGTTCTACTAGAAAGGACAGG - Intergenic
994468830 5:100176090-100176112 GTAGATTTATTAGCAAAAAGTGG + Intergenic
995221355 5:109652369-109652391 GCAAGGTTATTAGAAAAGATAGG + Intergenic
995659291 5:114463006-114463028 GGAGATTAATTATAAAGGACTGG + Intronic
997156628 5:131567379-131567401 TCATATTTATGAGAAAAGAATGG - Intronic
997630575 5:135365498-135365520 GCAGATTCATTACAGAAGGCAGG - Intronic
1001060275 5:168482420-168482442 GCAGATTTATTAGACAAAGCAGG + Intergenic
1001270032 5:170304076-170304098 CCATATTTATTAGGAAAGACAGG + Intergenic
1002675678 5:180910622-180910644 GCAGATTTATTAGAGAAAGTAGG - Intronic
1003082907 6:3036841-3036863 GCAGATTTATTAGATAAAGTAGG - Intergenic
1003083538 6:3042225-3042247 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1003888814 6:10545128-10545150 ACAGTTTTATTAGAAAGGAGGGG - Intronic
1003945270 6:11069817-11069839 GCAGATGAATCAGAAGAGACTGG - Intergenic
1004428211 6:15520656-15520678 GCAGATTTTTTAGAAGGGATAGG + Exonic
1005669258 6:28088322-28088344 GCATATATATTAGAAAAGATTGG - Intronic
1006217490 6:32457426-32457448 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1006486122 6:34343632-34343654 GCACATTTAGAAGAAAACACAGG + Intronic
1006533735 6:34680424-34680446 GCAGATAAATTAGAAAGAACTGG - Intronic
1006566044 6:34958321-34958343 ATAGATTCAATAGAAAAGACAGG - Intronic
1008307415 6:49920106-49920128 GAATATTTATTAGAAAAGAAAGG + Intergenic
1008334129 6:50279767-50279789 GCAGAATTATTTGCTAAGACTGG + Intergenic
1008352763 6:50512625-50512647 GCAGAAGGATTAGAAAAGTCTGG - Intergenic
1008463304 6:51800977-51800999 ACATATTTAATAGAAAACACAGG - Intronic
1008974605 6:57410016-57410038 GCACTATTAGTAGAAAAGACTGG + Intronic
1009163493 6:60311525-60311547 GCACTATTAGTAGAAAAGACTGG + Intergenic
1009485475 6:64216955-64216977 ACAGGTTTATTGAAAAAGACTGG - Intronic
1011330754 6:86203662-86203684 ACAGTTTGAATAGAAAAGACAGG - Intergenic
1013773299 6:113650958-113650980 AGAGATTTATTAGGAAAAACGGG - Intergenic
1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG + Intergenic
1018128774 6:160707785-160707807 GTAGTTTTATTTGAAAAGAAAGG + Exonic
1018608509 6:165623855-165623877 TCAGAGTTATTGGAACAGACAGG - Intronic
1018826620 6:167412580-167412602 GCAGATTTATTAGAGAAAGTAGG + Intergenic
1019227484 6:170525451-170525473 GCCAATTTATAGGAAAAGACAGG + Intergenic
1020718734 7:11713944-11713966 GCAAATATATTAGAATAGAAAGG + Intronic
1021725721 7:23546496-23546518 TCATATTTATTTGAAAAAACAGG + Intergenic
1023320917 7:38996693-38996715 GCAGAGTTGTTAGAACAGTCTGG - Intronic
1024107998 7:46112790-46112812 GCAGATTTACTTGAAGAAACAGG - Intergenic
1025009583 7:55385305-55385327 GCAGATTTATTAGAGAAAGAAGG + Intronic
1026396442 7:69959156-69959178 GCAGTTATATTAGGAAGGACAGG - Intronic
1026918429 7:74137341-74137363 GCAGATTAATTAGAAAAAGGGGG + Intergenic
1029291098 7:99503006-99503028 GTAAATATATTAGAAAAGAATGG + Intronic
1029866162 7:103631682-103631704 GTAAATTTATTAGAAGAGTCAGG + Intronic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1030052001 7:105546266-105546288 GCAGATTTATCAGAAATGAGTGG + Intronic
1030088685 7:105838699-105838721 GCAGAGTAATTAGAAAGGAGTGG - Intronic
1030973233 7:116088141-116088163 GCTGATGAATGAGAAAAGACTGG - Intronic
1031437277 7:121748421-121748443 GAAAATTAATTAGAAAAGAAGGG - Intergenic
1032329935 7:130968855-130968877 GAAGATGTGTTAGAAATGACCGG - Intergenic
1032786360 7:135203739-135203761 GGAAATTTATGAGAAAAGAGGGG + Intronic
1032861914 7:135888200-135888222 GCAGATGTAGTAGAAATAACAGG + Intergenic
1036522024 8:9500759-9500781 GCAGATTTATTAGAGAAAGTTGG + Intergenic
1036595214 8:10205757-10205779 GAATATTTATGTGAAAAGACTGG - Intronic
1036933474 8:12978390-12978412 GCAGATTTATTAGAGAAAGTTGG - Intronic
1037193852 8:16162571-16162593 GCAGATTTATTAACAAAAGCAGG + Intronic
1037288460 8:17325509-17325531 GCAGATCCATTCTAAAAGACTGG - Intronic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1037563002 8:20091403-20091425 GCAGATGTAAAAGAAAAGGCAGG - Intergenic
1037965907 8:23134120-23134142 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1038200444 8:25408078-25408100 GCAAGTTTAAGAGAAAAGACTGG + Exonic
1038582384 8:28759978-28760000 CCAGGTTTCTTAGAAGAGACTGG - Intergenic
1039179819 8:34854115-34854137 ACAGGTATATTACAAAAGACAGG + Intergenic
1040851798 8:51908657-51908679 GCAGATCTAGGAGAAAAGGCTGG - Intergenic
1041212408 8:55565699-55565721 GCAGAATTATAAGAAATGAGAGG + Intergenic
1041802760 8:61817762-61817784 ACAGATTTATTGCAAATGACTGG + Intergenic
1043522445 8:81061027-81061049 GTAGACTTTGTAGAAAAGACTGG + Intronic
1043524049 8:81077002-81077024 GCTGACATTTTAGAAAAGACAGG - Intronic
1045412713 8:101934655-101934677 GCAGTTTTATTAGATATGACAGG + Intronic
1045592355 8:103612741-103612763 GCTGATTTTTTAGTAGAGACAGG + Intronic
1045635307 8:104179450-104179472 GCATTATTATTAGTAAAGACTGG - Intronic
1047605805 8:126473148-126473170 GCAGATTTATTAGAGAAAGTAGG - Intergenic
1048431655 8:134376741-134376763 ACAGATTTATTAAAGAACACAGG + Intergenic
1048574435 8:135679785-135679807 GGAGATTTCTCAGCAAAGACTGG - Intergenic
1050989237 9:12126574-12126596 TCATATTTTTTAGTAAAGACAGG + Intergenic
1052520316 9:29539019-29539041 TCAGATTAAGGAGAAAAGACTGG - Intergenic
1052910695 9:33878635-33878657 GCAGATTTATTAGAGAACATAGG + Intronic
1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG + Intronic
1055523753 9:77109111-77109133 GCAGGTTGTTTAAAAAAGACAGG + Intergenic
1056568417 9:87795312-87795334 GCAGAATTGTCAGAAAACACAGG + Intergenic
1056824918 9:89870259-89870281 GCTGATTTATTAGAGAAAATGGG + Intergenic
1056940410 9:90950903-90950925 CCATATTAATTAGAAAAGTCAGG + Intergenic
1057096922 9:92319276-92319298 GCCAACTTGTTAGAAAAGACAGG - Exonic
1057916901 9:99063672-99063694 GCAGATTAATCAGAAGGGACAGG + Intronic
1058254028 9:102738338-102738360 GAAGATTCATTAGAAAAAAAAGG - Intergenic
1059247462 9:112861002-112861024 ACAGATTTATTAGAAAAAGTAGG + Intronic
1059779352 9:117509654-117509676 ACAGATTTATTAGAAGTGAGAGG - Intergenic
1061332563 9:129905194-129905216 AAAGATTGATTAGGAAAGACTGG - Intronic
1186314942 X:8359078-8359100 GTAGTTCTATTAGAAAACACTGG - Intergenic
1190083266 X:47373331-47373353 GCAGATTTATTAGAGAAAGGAGG + Intronic
1193125091 X:77862795-77862817 GCAGATTTATTAGAGAAAGTAGG - Intronic
1193541546 X:82778908-82778930 GCAAATTTATTAGATATTACTGG - Intergenic
1194095490 X:89633644-89633666 GCATATTTATGAGCTAAGACTGG - Intergenic
1195086252 X:101417110-101417132 GCAGATTTATTAGAGAAAGTAGG + Intergenic
1195431541 X:104795044-104795066 GTAGGTTTATTTGGAAAGACTGG - Intronic
1195963456 X:110408963-110408985 GCAGATTTATTATAAAAGAGAGG + Intronic
1198339719 X:135702059-135702081 ATAGATTTATAAGAAAAGAATGG - Intergenic
1200340923 X:155394861-155394883 GCAGATTTACAAGAAAAAAAAGG + Intergenic
1200448123 Y:3289823-3289845 GCATATTTATGAGCTAAGACTGG - Intergenic