ID: 949710192

View in Genome Browser
Species Human (GRCh38)
Location 3:6862724-6862746
Sequence TAGTGGGTGAGGGGGGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1129
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 1037}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949710192_949710209 16 Left 949710192 3:6862724-6862746 CCCCCCGCCCCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 87
4: 1037
Right 949710209 3:6862763-6862785 CCCAAGCCAAATCCTCGGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 95
949710192_949710206 11 Left 949710192 3:6862724-6862746 CCCCCCGCCCCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 87
4: 1037
Right 949710206 3:6862758-6862780 CAGACCCCAAGCCAAATCCTCGG 0: 1
1: 0
2: 5
3: 22
4: 189
949710192_949710211 19 Left 949710192 3:6862724-6862746 CCCCCCGCCCCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 87
4: 1037
Right 949710211 3:6862766-6862788 AAGCCAAATCCTCGGCTTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
949710192_949710214 30 Left 949710192 3:6862724-6862746 CCCCCCGCCCCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 87
4: 1037
Right 949710214 3:6862777-6862799 TCGGCTTGGAGGACGATTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949710192 Original CRISPR TAGTGGGTGAGGGGGGCGGG GGG (reversed) Intronic
900174013 1:1284100-1284122 GGGGGGGTGAGGGGGGTGGGGGG + Intronic
900205656 1:1431037-1431059 TAGGGGGTGAGGGGGTGAGGGGG - Intergenic
900243782 1:1628670-1628692 TGGTGGCTGATGGGGCCGGGGGG + Exonic
900317157 1:2062940-2062962 GGGTGGGTGATGGGGGCTGGGGG - Intronic
900577370 1:3389951-3389973 CAGAGGGTGGGGGGGGGGGGGGG - Intronic
900706346 1:4082505-4082527 TACTGGGGGAGGGAGGCTGGGGG + Intergenic
900965993 1:5959030-5959052 GAGTGGGGGCGGGGGGCGGGGGG + Intronic
901323001 1:8350644-8350666 GAGTGGTGGCGGGGGGCGGGGGG - Intergenic
901619160 1:10568326-10568348 TAGTGGGAGTGGGGGGGGGGGGG - Intronic
901659089 1:10787505-10787527 CCGGGGGCGAGGGGGGCGGGCGG + Intronic
901897557 1:12327462-12327484 TGGTGGGGGTGGGGGGTGGGAGG - Intronic
902108487 1:14058146-14058168 TAGTGGGGGAAGGTGGAGGGAGG - Intergenic
902651807 1:17842353-17842375 TAGTGGGGGCGGGGGGAGTGGGG - Intergenic
903338760 1:22641729-22641751 TTCTGGGTGAGCGAGGCGGGGGG - Intergenic
903384276 1:22916500-22916522 TAGCGGGTGGGGTGGGTGGGTGG - Intergenic
903642558 1:24869980-24870002 TAGTGGCGGCGGGGGGGGGGGGG - Intergenic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
903795720 1:25927564-25927586 CAGGGGGTCAGGGGGGTGGGGGG + Intergenic
904191245 1:28745718-28745740 TTTTGGGGGGGGGGGGCGGGGGG - Intronic
904365241 1:30006880-30006902 TAGGGGGTGAGGGCTGGGGGAGG - Intergenic
904563051 1:31411603-31411625 TAGTGGGTTGGGGGTGAGGGTGG + Intronic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904622917 1:31786124-31786146 TAGTGGGTGAGGGCGGCAGCAGG - Intergenic
905006242 1:34712520-34712542 TAGTGGGACAGGGGGGCCTGAGG - Intergenic
905199813 1:36307894-36307916 TAGTGGGGGAAGGGGCAGGGAGG - Intronic
905408556 1:37753394-37753416 TGGTGGATGAGGGGGGACGGGGG + Intronic
905452164 1:38063840-38063862 GAGGGGGTGAGGGGGGAGTGGGG + Intergenic
905524062 1:38623474-38623496 TGGTGGGTGGGGGGGGGGGTAGG - Intergenic
905802520 1:40854314-40854336 TAGTGGGGGGCGGGGGCGGGGGG - Intergenic
906143534 1:43547179-43547201 TGGTGGGTGAGTGGGGTGGGTGG - Intronic
906210571 1:44010449-44010471 TTGTGGGCGGGGGGGGGGGGGGG + Intronic
906264542 1:44418174-44418196 TAGTGGGTGCACGGGGCGTGAGG + Intronic
906753978 1:48291586-48291608 TACTGGGTGAGGGGGGCAGGTGG - Intergenic
906940429 1:50250961-50250983 TAGATGGTGAGGGTGGCAGGTGG + Intergenic
906953018 1:50349699-50349721 TAGTGTGTGAGGGGAGTGTGGGG - Intergenic
907053034 1:51342595-51342617 TGGTGGGCGAGGGGTGAGGGTGG + Intronic
907733838 1:57092664-57092686 TGGCGGGGGAGGGGGGTGGGGGG + Intronic
908277852 1:62494657-62494679 CAGTTGGTGGGGGGGGCAGGAGG + Intronic
908457819 1:64321274-64321296 TGGGGGGTGGGGGGGGGGGGTGG + Intergenic
908615964 1:65922996-65923018 TTGTGGGGGAGGGGGTTGGGGGG - Intronic
909170435 1:72286486-72286508 GGGTGGGGGAGGGGGGAGGGGGG - Intergenic
909472884 1:76049325-76049347 AGGTGGGGGAGGGGGGAGGGAGG - Intergenic
910510748 1:88001411-88001433 TGATGGGTGAGGGGGTGGGGGGG + Intergenic
911087156 1:93988600-93988622 CAATGGGTGTGGGGGGGGGGGGG + Intergenic
911406681 1:97449427-97449449 AAGTGGGAGAGGGAGGTGGGAGG + Intronic
911728985 1:101272195-101272217 TTGTGGGGTAGGGGGGAGGGGGG - Intergenic
911961578 1:104310477-104310499 TTGTGTGTGGGGCGGGCGGGGGG + Intergenic
914530776 1:148522494-148522516 TGGTGGGGGGGGGGGGTGGGGGG + Intergenic
914703061 1:150150714-150150736 GAGCGGGGGAGGGGAGCGGGGGG + Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915255850 1:154627916-154627938 TGGTGGGGGAGGGTGGGGGGAGG - Intronic
915653069 1:157333782-157333804 TAGAGAGTGATGGGGGTGGGCGG - Intergenic
915725587 1:158014678-158014700 TATGGGGGGGGGGGGGCGGGGGG + Intronic
915835285 1:159171469-159171491 GAGGGGGTGTGGGAGGCGGGGGG + Intergenic
916420724 1:164635319-164635341 TGGGGGGCGAGGGGGGAGGGAGG + Intronic
916425329 1:164674848-164674870 TGGTGGGTGGGGGGGGGGGGGGG - Intronic
916545162 1:165797135-165797157 TTTTGGGTGAGGGGGATGGGGGG - Intronic
916759012 1:167800149-167800171 TAGTGGGTGGTGGGGGCTGGGGG + Intergenic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917312221 1:173690056-173690078 TCGGGGGGGGGGGGGGCGGGGGG - Intergenic
917484922 1:175447213-175447235 GAGTGGGTGAGGAGGGGGTGGGG + Intronic
917659747 1:177165272-177165294 TAGTGGGGGACGGGGCGGGGTGG - Intergenic
917859509 1:179132852-179132874 TGGTGGGAGAGGGGTGCGGACGG - Intronic
918387386 1:184023631-184023653 AAGTGCGTGAGGTGGGGGGGGGG + Intronic
918487576 1:185045644-185045666 GAGCCGGTGAGTGGGGCGGGCGG + Exonic
918704143 1:187640053-187640075 AAGAGGGTGTGGTGGGCGGGAGG + Intergenic
918904809 1:190478206-190478228 TGGGGGGTGGGGGGTGCGGGCGG + Intergenic
918914960 1:190623078-190623100 TGGGGGGTGAGGGAGGTGGGAGG + Intergenic
919194226 1:194263309-194263331 TACTGGGGGGGGGGGGGGGGCGG - Intergenic
919814292 1:201428048-201428070 TGGCGGGTGTGGGGGGGGGGGGG - Intronic
920037328 1:203074843-203074865 GCATGGGTGAGGGGGGCAGGTGG + Intronic
920552576 1:206875831-206875853 TTTTGGGGGAGGGGGGAGGGTGG - Intergenic
920817424 1:209347978-209348000 TATTGGGTGGTGGGGGCAGGTGG - Intergenic
920945224 1:210522763-210522785 TAGTGGGATTGGGGGGTGGGGGG - Intronic
921183019 1:212646188-212646210 GAGTGGGAGAAGGGGGCGGAGGG - Intergenic
921257453 1:213355274-213355296 GAGTGGGTGAAGGGGGCTGGTGG + Intergenic
921595651 1:217051188-217051210 GAGTGGATAATGGGGGCGGGGGG + Intronic
921817708 1:219582583-219582605 TAGTGGTTGACTGGGGCTGGGGG - Intergenic
921995739 1:221416168-221416190 GAGTGGGTGGGTGGGGTGGGAGG - Intergenic
922416149 1:225425211-225425233 TAGTGGGAGAGTGGGGGGGGAGG + Intronic
922917718 1:229271559-229271581 TAGCGGGTGCGCGGGGCGCGGGG + Intronic
923230798 1:231984487-231984509 TAGTGGATGGGGGGCGTGGGTGG + Intronic
923567621 1:235088251-235088273 GAGTGGGAGAGGGGTGCAGGTGG + Intergenic
923762550 1:236860072-236860094 TGGTGGGGGGGGGGGGGGGGGGG - Intronic
924436661 1:244048847-244048869 TGGGGGGTGGGGGGGCCGGGAGG + Intergenic
924452523 1:244190946-244190968 GGGTGGGGGGGGGGGGCGGGGGG + Intergenic
924539890 1:244970737-244970759 AAGAGGGTGAAGAGGGCGGGAGG - Exonic
924581916 1:245330599-245330621 GAGTGGGGGAGGGAGGAGGGAGG + Intronic
924697984 1:246419807-246419829 TATAGAGTGAGGGGGGCGGATGG - Intronic
1062878224 10:958817-958839 TAGTGGGTGATGTGGGCAGCAGG - Intergenic
1062934657 10:1376856-1376878 TGGTGGGGCAGGGGGGTGGGTGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064135446 10:12746744-12746766 AACTGTGTGACGGGGGCGGGAGG + Intronic
1064747327 10:18490844-18490866 CGGTGGGGGAGGGGGGAGGGTGG + Intronic
1064816257 10:19267405-19267427 TAATGTGTGAGGGGTGGGGGAGG - Intronic
1065099705 10:22321191-22321213 CTGTGGGGGAGGCGGGCGGGCGG - Exonic
1065504780 10:26418949-26418971 TCGTGGGGGAGGGGGAAGGGAGG - Intergenic
1066014665 10:31228788-31228810 TTGTGGGGTAGGGGGGCGAGGGG - Intergenic
1066025984 10:31361552-31361574 CAGATGGTGAGGGGGCCGGGTGG + Intronic
1066134158 10:32426675-32426697 TAGAGAGAGAGGGGGGTGGGGGG + Intergenic
1066223441 10:33358231-33358253 TATTGGGTGAGGGGCGGTGGTGG - Intergenic
1066365906 10:34776832-34776854 TTGTGGGGGGGGGGGGCGGGTGG + Intronic
1066382192 10:34911311-34911333 GGGTGGGGGGGGGGGGCGGGTGG - Intergenic
1067003850 10:42642559-42642581 TAGAGGGTGAGGGGGTAGTGGGG - Intergenic
1067985258 10:51136579-51136601 GTGTGTGGGAGGGGGGCGGGGGG + Intronic
1068197158 10:53731678-53731700 TGTTGGGGGATGGGGGCGGGGGG + Intergenic
1068673032 10:59743198-59743220 TGGTGGGGGGCGGGGGCGGGTGG - Intergenic
1068731476 10:60363080-60363102 GGGCGGGGGAGGGGGGCGGGGGG + Intronic
1069158136 10:65054217-65054239 TGGTGGGTGATGGCGCCGGGAGG - Intergenic
1069178640 10:65327265-65327287 TTGGGGGTGGGGGGCGCGGGGGG - Intergenic
1069817583 10:71208409-71208431 TAGTGGGTGCCAGGGGCTGGGGG + Intergenic
1069909408 10:71750430-71750452 TAGGGGATGGGGAGGGCGGGGGG + Exonic
1071764665 10:88649185-88649207 TAGGGAGGGAGGGGGGAGGGAGG + Intergenic
1072110467 10:92314742-92314764 TATTGGCGGGGGGGGGCGGGGGG - Intronic
1072612542 10:97028276-97028298 CAGAGGGTGAGTGGGGTGGGAGG - Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073216707 10:101840542-101840564 AAGTGGGGGGGGGGTGCGGGGGG - Intronic
1073286909 10:102395094-102395116 TATTAGGTGGGGGGGGGGGGGGG + Intronic
1073579690 10:104653937-104653959 TAGTGGGGGAGAGGGGGAGGTGG - Intronic
1073599388 10:104831840-104831862 AAGTAGGTGATGGGGGAGGGGGG + Intronic
1073711252 10:106045318-106045340 TAGTGGGTGGGGTGGGGGGTGGG + Intergenic
1073874198 10:107902357-107902379 TGGGGGGGGGGGGGGGCGGGTGG + Intergenic
1073941755 10:108707219-108707241 TAGTGGTTGGGGGGTGGGGGTGG + Intergenic
1073959808 10:108912645-108912667 TCGGGGGGGTGGGGGGCGGGGGG + Intergenic
1074034534 10:109724955-109724977 TTGTGGGGTAGGGGGGTGGGAGG + Intergenic
1074165594 10:110871752-110871774 AAGTTGGGGAGGGGCGCGGGAGG - Intergenic
1074876082 10:117614412-117614434 TAGTGGGGGTGGGGGGGTGGCGG + Intergenic
1075131511 10:119743643-119743665 TGCTGGGGGCGGGGGGCGGGGGG + Intronic
1075246367 10:120825527-120825549 TTGTGGGGGAGGGGCGAGGGCGG + Intergenic
1075318270 10:121469299-121469321 TAGTGGGGGAGCGGGGTGTGGGG - Intergenic
1075857000 10:125638162-125638184 CAGTGGGGGATGGGGGCTGGGGG - Intronic
1075922706 10:126226186-126226208 TGGTGGGGGGAGGGGGCGGGGGG + Intronic
1076571625 10:131437199-131437221 TGGAGGGTGATGGGGGTGGGAGG - Intergenic
1076800400 10:132820327-132820349 TGGTGGCTGACGGGGGCTGGGGG + Intronic
1076934738 10:133559778-133559800 TAGCGGGTGAGGGGGAAGGAAGG + Intronic
1076948497 10:133666764-133666786 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1076951455 10:133676672-133676694 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1076952445 10:133679982-133680004 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1076955401 10:133742943-133742965 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1076956391 10:133746253-133746275 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1076957379 10:133749562-133749584 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1076959352 10:133756171-133756193 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
1077014442 11:393512-393534 TAGGGGGTGAGGGGGTCCTGGGG + Intronic
1077016763 11:401702-401724 TCGGGGGTGAGCGGGGCCGGGGG - Intronic
1077016803 11:401787-401809 TCGGGGGTGAGCGGGGCCGGGGG - Intronic
1077016879 11:401950-401972 TCGGGGGTGAGCGGGGCCGGGGG - Intronic
1077017049 11:402322-402344 TCGGGGGTGAGCGGGGCCGGGGG - Intronic
1077017182 11:402608-402630 TCGGGGGTGAGCGGGGCCGGGGG - Intronic
1077017206 11:402661-402683 TCGGGGGTGAGCGGGGCCGGGGG - Intronic
1077207836 11:1352802-1352824 TGGTGGGGGTGGGGGGTGGGGGG - Intergenic
1077449883 11:2634314-2634336 TGGGGGGGGAGGGGGGAGGGGGG - Intronic
1077475528 11:2788549-2788571 GGTTGGGTGTGGGGGGCGGGGGG - Intronic
1077492208 11:2866753-2866775 TTCTCAGTGAGGGGGGCGGGAGG + Intergenic
1077504103 11:2922297-2922319 GGGTGGGTGTGGGGGGCTGGAGG - Intronic
1077901657 11:6494967-6494989 TAGGGGGTGGGGGGTGTGGGGGG - Intronic
1078018613 11:7636823-7636845 ATGTGGGTGAGAGGGGAGGGTGG - Intronic
1078166956 11:8895246-8895268 TTGTGGGGTAGGGGGGTGGGAGG + Intronic
1078187854 11:9067861-9067883 CAGTTGCTGAAGGGGGCGGGGGG - Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078417616 11:11178719-11178741 TAGGGGGTGGGGTGGGGGGGGGG + Intergenic
1078545303 11:12242578-12242600 AAGTGGGTGAGGGAGGCAGCCGG - Intronic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079492939 11:21009933-21009955 CAGTGGGTGGGGGGAGGGGGAGG - Intronic
1079645912 11:22863644-22863666 TAGTGGCGGAGGGAGGTGGGGGG + Intergenic
1080037358 11:27722884-27722906 TAGAGGGGGAGGCGGGAGGGGGG + Intergenic
1080576555 11:33604800-33604822 GAGAGGGTGAGGGGGGAGTGAGG + Intronic
1080746480 11:35112612-35112634 CAGCAGGTGATGGGGGCGGGGGG + Intergenic
1080746485 11:35112619-35112641 TGATGGGGGCGGGGGGCGGGGGG + Intergenic
1081534321 11:43986300-43986322 GAGTGGGTGGGGGGTGGGGGTGG - Intergenic
1081621159 11:44619910-44619932 CAGTGGGAGAGGGGAGAGGGTGG + Exonic
1081647842 11:44802308-44802330 AAGTGGTTGAGGTGGGTGGGGGG + Intronic
1081729039 11:45355597-45355619 TAGCCGGTGAGGAGGGTGGGGGG + Intergenic
1081915994 11:46730530-46730552 CAGTGGGTGAGGGGAGAGAGGGG + Intronic
1082052762 11:47786026-47786048 TAGTGGATGATGGGGGCTGATGG + Intronic
1082788064 11:57328239-57328261 CAGTGGGTGGGGGGCGTGGGAGG - Intronic
1082816808 11:57514760-57514782 GAGTGAGTGAGGGGCGCGCGGGG - Intronic
1083063950 11:59903993-59904015 TTTTGGGGGAGGGGGGAGGGGGG + Intergenic
1083069745 11:59965143-59965165 GGGTGGGGGAGGGGGGAGGGGGG + Intergenic
1084184669 11:67465162-67465184 TGGTGGGTGAGCCGGGCTGGGGG - Intronic
1084296190 11:68214343-68214365 TAGTGGGTGCTGGGGGCGGCGGG - Intergenic
1084309762 11:68310165-68310187 TAGTGGGTGGTGGTGGTGGGGGG + Intergenic
1084574700 11:69981660-69981682 TAGCGGGAGAGGAGGGCTGGAGG - Intergenic
1084587892 11:70073840-70073862 TCTTGGGGGTGGGGGGCGGGGGG - Intergenic
1085050501 11:73377683-73377705 GCGCGGGGGAGGGGGGCGGGGGG - Intronic
1087250440 11:95893080-95893102 TAGTGAGTGAGGAGGATGGGTGG - Intronic
1087772207 11:102222874-102222896 TGGCGGGGGAGGGGGTCGGGGGG + Intronic
1089133297 11:116229299-116229321 TTGTGGGTGAGGGGAGCCGCAGG - Intergenic
1089389178 11:118088489-118088511 TAGCGGGTGAGGTGGGGAGGTGG - Intronic
1089526611 11:119101254-119101276 TAAGTGGTGAGGGGGGCGGAGGG + Intronic
1089837547 11:121384249-121384271 TATGGGGTGGGGGAGGCGGGAGG + Intergenic
1090032338 11:123217826-123217848 TGGAGGGTGAGGGTGGGGGGGGG - Intergenic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090457950 11:126866148-126866170 TAGAGAGTGATGGGGGAGGGAGG + Intronic
1090957890 11:131529927-131529949 TAGTGTGTGAGGGGGAGAGGTGG - Intronic
1090964037 11:131582777-131582799 TGGTGGGGGAAGGGGGCGTGGGG - Intronic
1091190657 11:133693085-133693107 GGGTGGGGGCGGGGGGCGGGAGG - Intergenic
1091589821 12:1836447-1836469 GGGTGGGTGAGGTGGGCTGGGGG + Exonic
1092139219 12:6171368-6171390 TAATGGGGGGGGGGGGAGGGGGG + Intergenic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092491573 12:8949970-8949992 AAGAGGGTGAGAGGGGCAGGTGG + Intergenic
1092499347 12:9030224-9030246 TAGTGGATGGGGTGGGCAGGTGG + Intergenic
1092522090 12:9285715-9285737 TAGGGGGTGAGGAGTGGGGGTGG + Intergenic
1092545192 12:9446141-9446163 TAGGGGGTGAGGAGTGGGGGTGG - Intergenic
1092959672 12:13584129-13584151 GAGTGGGTGAGGGAGGAGAGTGG - Intronic
1093019943 12:14193950-14193972 AAGTGGGCGACGGGGGCGGGTGG + Intergenic
1093027241 12:14256006-14256028 TAAGGGGTGGGGGGGGAGGGTGG + Intergenic
1093930590 12:24951742-24951764 TTGAGGGAGAGGGGGGCGAGGGG - Intergenic
1094251043 12:28361869-28361891 GTGTGTGGGAGGGGGGCGGGAGG + Intronic
1094507755 12:31075908-31075930 TAGGGGGTGAGGAGTGGGGGTGG + Intronic
1094565003 12:31591051-31591073 GGGTGGGGGAGGGGCGCGGGGGG + Exonic
1095472713 12:42553521-42553543 CAGGGGGTGGGTGGGGCGGGGGG + Intronic
1096218445 12:49811453-49811475 TAGTGGATGAGGAGGTGGGGAGG - Intronic
1096352180 12:50909572-50909594 TAGTTGGGGAGGGAGTCGGGGGG + Intergenic
1096617537 12:52842494-52842516 GAGTAGGTGAGGTGGGCGGCAGG - Intronic
1096675018 12:53221614-53221636 AAGGGGGTGAGGTGGGCGGGGGG + Intronic
1097177704 12:57152898-57152920 CAGTGGGTGAGGGTGGGGTGGGG - Intronic
1097338829 12:58414740-58414762 GAGTGGGTGGGGGGGTGGGGAGG + Intergenic
1097686239 12:62693736-62693758 TAGTGGGGGTGGGAGGTGGGCGG - Intronic
1098774057 12:74588937-74588959 GAGAGGGAGAGGGGGACGGGGGG + Intergenic
1099293727 12:80804353-80804375 TAGTGGAGGAGTGGGGAGGGAGG - Intronic
1099790188 12:87324230-87324252 TGGTGGGGGAGTGGGGCAGGGGG - Intergenic
1099972282 12:89512649-89512671 CAGAGGCTGAGGGAGGCGGGCGG + Intronic
1100691920 12:97047497-97047519 TAGTGGGTGAAGTGGCAGGGAGG - Intergenic
1100726736 12:97416880-97416902 TGGGGGGTGTGGGGGGAGGGGGG + Intergenic
1101049055 12:100842059-100842081 CAGTGGGGGGGGGGGGGGGGTGG - Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101477599 12:105065225-105065247 TAATCGGGGAGGGGGGTGGGGGG + Intronic
1101808888 12:108090867-108090889 TGGTGGGGGAGCGGGGGGGGGGG - Intergenic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102024335 12:109705071-109705093 TAGTTGGTGAAAGGGGTGGGCGG - Intergenic
1102214161 12:111148353-111148375 TGGTGGGTGTCTGGGGCGGGTGG + Intronic
1102532154 12:113554348-113554370 GAGTGGGTGATGGTGGGGGGTGG + Intergenic
1102645478 12:114400924-114400946 GAGTGTGTGAAGGGGGAGGGTGG - Intronic
1103479948 12:121244517-121244539 TGGGGCCTGAGGGGGGCGGGTGG - Intronic
1103520614 12:121535389-121535411 TAGTGGGTGTCAGGGGCTGGGGG + Intronic
1103572864 12:121856654-121856676 TAGTGGCTCAGGGGGGCATGGGG + Intronic
1103759054 12:123234393-123234415 TTGTGGGGGAGGGGGGTAGGGGG + Intronic
1103823436 12:123716904-123716926 TAGTGGGTGCTGGGGGGGTGGGG - Intronic
1103927669 12:124432850-124432872 AAGTGGCGGCGGGGGGCGGGGGG + Intronic
1103927908 12:124433936-124433958 TGGCGGGGGTGGGGGGCGGGAGG - Intronic
1103954451 12:124568418-124568440 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104360558 12:128129147-128129169 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104413254 12:128577092-128577114 TAGTGGTTGATGGGGGCTGTGGG - Intronic
1104509674 12:129365939-129365961 GTGTGGGTGTGCGGGGCGGGTGG - Intronic
1104620989 12:130312837-130312859 ATGTGGGGGGGGGGGGCGGGGGG - Intergenic
1105262680 13:18791554-18791576 TAGTGGGAGTTGGGGGTGGGTGG - Intergenic
1105437579 13:20391226-20391248 TAGGGGGAAAGGGAGGCGGGGGG + Intergenic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1105619613 13:22053972-22053994 TAGTGGGAGGGGGAGGGGGGTGG + Intergenic
1106516257 13:30456753-30456775 TTGTGGGCGGGGGGGGGGGGTGG + Exonic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1106999092 13:35522838-35522860 CAGGGGGTGAGGGGGTGGGGTGG - Intronic
1107484459 13:40813121-40813143 GTGTGGGTGGGGGGGGGGGGGGG - Intergenic
1108203723 13:48067181-48067203 CAGTGGTTGGGGGGGGAGGGAGG - Intronic
1108733275 13:53256926-53256948 AAGTGGGAGATGGGGGCTGGAGG + Intergenic
1109198313 13:59403610-59403632 TAGTGGGGGACTGGGGTGGGAGG + Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1111330620 13:86759454-86759476 TAGAGTGTGTGGGGGGCAGGAGG + Intergenic
1111927388 13:94478151-94478173 CTGGGGGTGGGGGGGGCGGGCGG - Intronic
1112377873 13:98860666-98860688 GCGTGGGTGAGGGTGGAGGGTGG + Intronic
1112443624 13:99444090-99444112 CTGGGGGTGATGGGGGCGGGTGG - Intergenic
1113374196 13:109748985-109749007 TAATGGGTGAGTGGGGAGGAAGG + Intergenic
1113494075 13:110714076-110714098 TATTTTTTGAGGGGGGCGGGGGG + Intronic
1113841643 13:113364347-113364369 GAGCGGGTGAGGGGCGGGGGAGG + Intergenic
1114528308 14:23379699-23379721 TATTGGGGGAGGGGGGGTGGAGG + Exonic
1114626095 14:24131411-24131433 AGGTGGGGGAGAGGGGCGGGGGG - Exonic
1114836865 14:26212825-26212847 TTGTGTGTGTCGGGGGCGGGGGG - Intergenic
1115434796 14:33360338-33360360 AATTGGGTGGTGGGGGCGGGAGG + Intronic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1117091815 14:52258706-52258728 TAATGGGTGAGTGGGGGTGGGGG + Intergenic
1118672662 14:68146427-68146449 TTGTGGGGGAGGGGGCCGTGGGG - Intronic
1118696962 14:68394890-68394912 GCGGGGGTGAGGGGGGCTGGAGG - Intronic
1118712667 14:68535381-68535403 TGGGGGGTGAGGGGTGGGGGTGG - Intronic
1119005195 14:70919711-70919733 TGGTGGGGGGGGGGGGGGGGGGG - Intronic
1119005199 14:70919715-70919737 TATTTGGTGGGGGGGGGGGGGGG - Intronic
1119613041 14:76079929-76079951 GAGTGGGGGAGTGGGGAGGGGGG + Intronic
1120542881 14:85772376-85772398 TTGTGGGGTGGGGGGGCGGGGGG - Intergenic
1121132840 14:91464320-91464342 TGGGGGGTGAGGGAGGGGGGTGG - Intronic
1121546638 14:94768175-94768197 TGGTGGGTGGGTGGGGCGGGGGG + Intergenic
1121796692 14:96741707-96741729 TGGGGGGCGAGGGGGGCGAGGGG + Intergenic
1122023754 14:98859749-98859771 AAGTGGGTTAGGGATGCGGGTGG + Intergenic
1122186874 14:100006011-100006033 TTGTCGGTGTGGGGGGGGGGGGG - Intronic
1122464137 14:101918645-101918667 GAGGGGGCGAGGGGGGCGAGGGG - Intronic
1122606098 14:102948332-102948354 TTGGAGGTGAGGGGGGTGGGGGG + Intronic
1122798892 14:104220132-104220154 CATTGGGGGAGGGGGCCGGGTGG - Intergenic
1122855238 14:104556882-104556904 GGGTGGGTGAGGGGGCCTGGGGG - Intronic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1123998489 15:25734994-25735016 TGGTGGGAGCGGGGGGGGGGTGG + Intronic
1124139360 15:27063867-27063889 AAGTGGGTGAGCAGGCCGGGTGG - Intronic
1124245368 15:28066402-28066424 TGATGGGAGAGGGGGGTGGGAGG + Intronic
1124707659 15:31978721-31978743 TGGTGGGTGAGGGGGACAGTTGG + Intergenic
1125694206 15:41621702-41621724 GAGAGGGTGGCGGGGGCGGGGGG + Intronic
1125919566 15:43517597-43517619 TAGGGTGGGAGTGGGGCGGGCGG - Intronic
1126037150 15:44557315-44557337 GGCTGGGTGAGGGGGGAGGGGGG - Intronic
1126350286 15:47738844-47738866 TAGTAGGTGAGGGGGGCTCCAGG + Intronic
1126469329 15:48990840-48990862 ATGTGTGTGAGGGGGGTGGGGGG + Exonic
1126604804 15:50465344-50465366 TGGTGGGGGAGGGGAGGGGGAGG + Intronic
1127055454 15:55126568-55126590 AAGTGGGTGAGTGGGTCTGGTGG - Intergenic
1127254938 15:57281903-57281925 AACTGGGTGCGGGGGGCTGGGGG - Intronic
1127283014 15:57508190-57508212 TTGTGTGTGTGTGGGGCGGGGGG - Intronic
1127456250 15:59158553-59158575 TATTGGGTGGGAGGGGCTGGAGG + Intronic
1127459352 15:59183815-59183837 TAGTGGGGGAAGGGGAAGGGAGG - Intronic
1128065672 15:64763049-64763071 TAGTGGGTAGGGGGTGGGGGTGG + Intronic
1128140294 15:65295289-65295311 TAGTTGGGGCGGGGGGGGGGGGG + Intronic
1128582091 15:68817879-68817901 TTGTCGCTGTGGGGGGCGGGGGG - Intronic
1129178897 15:73859278-73859300 ACGGGGGTGGGGGGGGCGGGGGG - Intergenic
1129195224 15:73960618-73960640 TAGTGGTTGCCGGGGGCTGGAGG - Intergenic
1129503155 15:76059638-76059660 GCGTGGGTGAGGGGGTCGCGGGG - Intronic
1130137611 15:81195232-81195254 TAGTGGAGGAGGGGGGCTGTGGG + Intronic
1130200933 15:81826253-81826275 GAGTGGGTGAGGTGGGGTGGGGG + Intergenic
1130518767 15:84646115-84646137 TAGTGGCTGAGTTGGGCTGGGGG + Intronic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131371082 15:91882487-91882509 TAGTGGGGGTGGGGTGGGGGTGG - Intronic
1131583877 15:93672607-93672629 GGGTGGGGGTGGGGGGCGGGGGG + Intergenic
1132202332 15:99963538-99963560 AGGTTGGTGAGGGGGGGGGGGGG - Intergenic
1132484008 16:180918-180940 GGGTGGGTGCGGGGGGCGTGCGG + Intronic
1132671147 16:1102776-1102798 TGGGAGGTGAGGGGGGCTGGGGG - Intergenic
1132767359 16:1541272-1541294 CAGGAGGTGAGGGGGGCAGGTGG + Intronic
1132912564 16:2322524-2322546 TTGTGGGGTGGGGGGGCGGGGGG - Intronic
1132939619 16:2500352-2500374 GAGTGGCTGAGTGGGGCGGTGGG - Exonic
1133021140 16:2967440-2967462 TTGGGGGTGAGGCGGGCGCGCGG + Exonic
1133269534 16:4603893-4603915 CAGTGGGTGTGGGGGGTTGGAGG - Intergenic
1133285923 16:4690785-4690807 TGGTGGGGGCGGGGGGCGGGCGG - Exonic
1133298419 16:4766996-4767018 CAGTGAGTGCGGGGGGCGCGGGG - Exonic
1133314250 16:4872448-4872470 TTGTGTGTGTGGGGGGTGGGTGG + Intronic
1133634282 16:7651333-7651355 TGGTGGGTGAAGGGAGCGGGTGG - Intronic
1133665813 16:7966722-7966744 TTGTGTGTGTGAGGGGCGGGAGG - Intergenic
1134449674 16:14355425-14355447 GAGTGGGGGGGGGGGGCGGGGGG + Intergenic
1134518219 16:14904070-14904092 TAGATGGGGTGGGGGGCGGGAGG + Intronic
1134608986 16:15592892-15592914 TTGGGGGGGGGGGGGGCGGGGGG - Intronic
1134705890 16:16302728-16302750 TAGATGGGGTGGGGGGCGGGAGG + Intergenic
1134847732 16:17454907-17454929 TAGTTGCGGGGGGGGGCGGGGGG - Intronic
1134961650 16:18409382-18409404 TAGATGGGGTGGGGGGCGGGAGG - Intergenic
1134965950 16:18491985-18492007 TAGATGGGGTGGGGGGCGGGAGG - Intronic
1135040244 16:19112775-19112797 TTGTGGGGGAGGGGGGAAGGGGG + Intergenic
1135048497 16:19173400-19173422 CATTGGGGGAGGTGGGCGGGGGG - Intronic
1135390545 16:22089621-22089643 TAGTGGGTGGTGGCGGGGGGTGG - Intergenic
1135552388 16:23408257-23408279 CAGGGGGCGAGTGGGGCGGGAGG + Intronic
1135552398 16:23408280-23408302 CAGGGGGCGAGTGGGGCGGGAGG + Intronic
1135552408 16:23408303-23408325 TAGGGGGCGAGTGGGGCGGGAGG + Intronic
1135552426 16:23408348-23408370 TAGGGGACGAGTGGGGCGGGAGG + Intronic
1135552435 16:23408371-23408393 TAGGGGACGAGTGGGGCGGGAGG + Intronic
1136551058 16:30982831-30982853 GAGAGGGTGAGGGGGACGGGAGG + Intronic
1136791132 16:32968762-32968784 TGGTGGGGGAGGGGGGCTGGGGG - Intergenic
1136878682 16:33885170-33885192 TGGTGGGGGAGGGGGGCTGGGGG + Intergenic
1137652922 16:50135854-50135876 TAGTGGGGGAGGTGGGAGGTAGG - Intergenic
1138427485 16:56945850-56945872 GGGGGGGTGGGGGGGGCGGGGGG - Intergenic
1138773928 16:59697484-59697506 TTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1139221993 16:65192902-65192924 TAGTGGCTGAGAAGGGTGGGTGG - Intergenic
1139343394 16:66286606-66286628 GAGAGGGTGTGGGGGGCGTGTGG + Intergenic
1139364516 16:66425691-66425713 GAGTGGGGGCGGGGGGGGGGCGG + Intergenic
1140063654 16:71592028-71592050 TAGCGGGGGGGGGGGGGGGGGGG - Intergenic
1140083931 16:71777306-71777328 CAGAGGGTGGGGGGAGCGGGAGG + Intronic
1140264670 16:73409975-73409997 TAGTGGGTGGGGCAGGGGGGTGG + Intergenic
1140280200 16:73546818-73546840 TGGGGGGTGAGGGGGGAGGGAGG + Intergenic
1140666591 16:77233793-77233815 ATGTGGGTGGGGGGGGCTGGGGG - Intergenic
1140784416 16:78326571-78326593 TTGCGGGGGGGGGGGGCGGGGGG - Intronic
1141102192 16:81206040-81206062 TTGGGGGGGGGGGGGGCGGGTGG - Intergenic
1141558128 16:84849334-84849356 TGGTGGGTGAGGGGAGGGGCTGG + Intronic
1141631397 16:85289983-85290005 TTGCGGGTGATGGGGGCAGGTGG + Intergenic
1141651794 16:85396752-85396774 GAGTGGGTGAGGGTGGCGGCAGG + Intergenic
1142130420 16:88429430-88429452 TAGTGGGTGGGGAGGGAGTGGGG - Exonic
1142145179 16:88489924-88489946 TGGTGGGTGAGGGAGGGAGGGGG + Intronic
1142280915 16:89147148-89147170 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142280936 16:89147227-89147249 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142280944 16:89147257-89147279 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142280979 16:89147367-89147389 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142280987 16:89147397-89147419 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142280995 16:89147427-89147449 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142281003 16:89147457-89147479 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142281011 16:89147487-89147509 GAGTGAGTGAGGGAGGAGGGAGG + Intronic
1142369666 16:89671550-89671572 TCGTGGGGTAGGGGGGAGGGGGG - Intergenic
1203093341 16_KI270728v1_random:1230223-1230245 TGGTGGGGGAGGGGGGCTGGGGG - Intergenic
1142606970 17:1087395-1087417 TGGTGGGGCAGGGGAGCGGGGGG + Intronic
1142707014 17:1701753-1701775 TCGCGGGGGAGGGGGGCGGGCGG + Intergenic
1143020904 17:3916801-3916823 TGGTGGGGGAGGGTGGAGGGTGG - Intergenic
1143544939 17:7590249-7590271 TCTTGGGTGGGGGGGGCGGGGGG - Intronic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1143595030 17:7909078-7909100 CAGTGGGTGAGGGGCTGGGGGGG - Intronic
1143702589 17:8672402-8672424 GTGAGGGTGAGGGCGGCGGGAGG - Intergenic
1143703177 17:8676621-8676643 TTGTTGGTGAGGGGGCAGGGAGG - Intergenic
1143807993 17:9445501-9445523 TGGTGGGGGAGGGGGTTGGGGGG + Intronic
1144068171 17:11642401-11642423 TGGTGGGGGCAGGGGGCGGGGGG + Intronic
1144312482 17:14025500-14025522 CAGTGGGTGAGGGGACCAGGAGG + Intergenic
1144332270 17:14235825-14235847 CAGTGGGTGAGGGGACCAGGAGG - Exonic
1144578894 17:16446927-16446949 TTGTGGGTGGGGGTGGGGGGCGG + Intronic
1144606110 17:16666928-16666950 TGGTGGGTGATGGCGCCGGGAGG + Intergenic
1144780745 17:17807242-17807264 CAGGCGGTGGGGGGGGCGGGGGG + Intronic
1145117841 17:20227954-20227976 CAGTGGGTGACGAGGGGGGGTGG + Intronic
1145759557 17:27418499-27418521 TTGTGGGTGAGGTGGAGGGGAGG + Intergenic
1145863501 17:28226416-28226438 TGGTGGGAGTGGGGGGTGGGAGG - Intergenic
1145991479 17:29081635-29081657 TGGGGGGTGAGGGGGGAGCGAGG + Intronic
1146312495 17:31779964-31779986 TAGTGGGGGTGGGGGGTGGGTGG - Intergenic
1146674003 17:34760549-34760571 TGTTGGGTGGGGGGGGCGGTAGG - Intergenic
1147042932 17:37731853-37731875 TGGTGAGTGAGGGGGGGCGGGGG + Intronic
1147153404 17:38531336-38531358 TGGCGGGGGAGGGGGGCTGGGGG - Exonic
1147184367 17:38705560-38705582 TCGGGGGTCAGGGGGGAGGGAGG - Exonic
1147263974 17:39224313-39224335 TACCGGGTGAAGGGGGAGGGAGG + Intronic
1147402794 17:40191258-40191280 CAGGGGGTGAGGGGAGTGGGTGG - Intronic
1147420381 17:40319520-40319542 CAGGGGGTGGGGGGGTCGGGGGG - Intronic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147587546 17:41661032-41661054 GAGTGGGGGTGGGGGGTGGGGGG - Intergenic
1147657432 17:42098663-42098685 CAGGGGGTGCGGGGGGTGGGTGG + Intergenic
1147867094 17:43560194-43560216 TAGTCGGGGAGGTGGGTGGGAGG + Intronic
1147986089 17:44308558-44308580 CACTGGCCGAGGGGGGCGGGCGG + Exonic
1147990012 17:44326813-44326835 CGGTGGCGGAGGGGGGCGGGCGG + Intergenic
1148001138 17:44387934-44387956 AAGTGGGTGAGTGGGGAGAGTGG - Intronic
1148329452 17:46804913-46804935 TTGGGGGTGGGGGGGGTGGGCGG - Intronic
1148603134 17:48908873-48908895 TAGTGGGAGAGGGTGGGGGGCGG - Intronic
1148641857 17:49193666-49193688 GAGAGGGTGAGGGGGGGGAGGGG + Intergenic
1148748399 17:49931124-49931146 TGGTGGGTGAGAGTGGAGGGAGG - Intergenic
1148777021 17:50101703-50101725 TAATGGGCGGTGGGGGCGGGAGG - Intronic
1148812113 17:50300021-50300043 TACTGGGTGAGGGTGGAGGGAGG - Intergenic
1148857412 17:50586339-50586361 CAGAGGGTGAGAGGGGCTGGTGG - Intronic
1149497784 17:57131206-57131228 TACTGGGTGCGGGGTGGGGGTGG - Intergenic
1149766641 17:59284323-59284345 TGGTGGGGGAGGGGGGCGTGGGG + Intergenic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1150251055 17:63704613-63704635 TAGCGGGTGGGGGGGGGGGGTGG + Intronic
1150326512 17:64262782-64262804 TCGCCGGTGAGGGGGGCGGCAGG + Intronic
1150488912 17:65561345-65561367 GCGTGGGCGCGGGGGGCGGGAGG - Intronic
1150679178 17:67270682-67270704 TAGTGGGTGTCAGGGGCTGGAGG - Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151579961 17:74972233-74972255 GGGTGGGTGGGGGCGGCGGGAGG + Intronic
1151605145 17:75131157-75131179 TAAGGAGAGAGGGGGGCGGGCGG - Intronic
1151626276 17:75277809-75277831 GAGTGGGAGATGGGGGCAGGGGG - Intronic
1151660715 17:75516636-75516658 GAGTGGGTGTCGGGGGCGCGGGG + Intronic
1151729243 17:75901155-75901177 TAGGAGGTGAGCGGGGCAGGAGG + Intronic
1151801489 17:76382349-76382371 TTGGAGGTGAGGGGGGCAGGGGG + Intronic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152141581 17:78540334-78540356 TGGTGGGTGGGTGGGGTGGGTGG + Intronic
1152141816 17:78541092-78541114 GGGTGGGTGAGCGGGGTGGGGGG + Intronic
1152141855 17:78541176-78541198 GGGTGGGTGAGCGGGGTGGGGGG + Intronic
1152241293 17:79162736-79162758 TTGTGGGTGGTGTGGGCGGGCGG + Intronic
1152586731 17:81192658-81192680 CAGCGGGTGAGGGGGCGGGGGGG + Intronic
1152624054 17:81380156-81380178 TAGTGGGAGTGGGGGGAGAGCGG - Intergenic
1152628551 17:81399450-81399472 GAGTGGGTGAGCGGGCGGGGCGG + Intronic
1152645000 17:81464811-81464833 GCGAGGGTGAGGGGGGCGAGGGG - Exonic
1152995197 18:399932-399954 TAAAGGGTGGTGGGGGCGGGTGG + Intronic
1153797080 18:8633725-8633747 CAGTGGGTGACGGAGGCGCGTGG - Intronic
1154163759 18:11998932-11998954 CATTGGGTGGGGGGGGGGGGGGG - Intronic
1154223502 18:12478668-12478690 AAGTGGGTGAGGGAGAAGGGAGG + Intronic
1154359012 18:13643431-13643453 TGATGGCTGCGGGGGGCGGGGGG + Intronic
1154966540 18:21363288-21363310 TTGTGTGTGTGGGGGGGGGGGGG - Intronic
1155551412 18:26969722-26969744 TAGAGAGTGAGGGAGGAGGGAGG + Intronic
1156258706 18:35424350-35424372 GACTGGGTGTGGGGGGTGGGAGG - Intergenic
1156812055 18:41264215-41264237 CAGTGGGTGGGTGGGGAGGGGGG + Intergenic
1157531926 18:48428670-48428692 AAGTGGGTGTGGGGAGAGGGAGG - Intergenic
1158243747 18:55407072-55407094 GGGTTGGTGCGGGGGGCGGGGGG + Intronic
1159184475 18:64950579-64950601 TGGCGGGGCAGGGGGGCGGGGGG + Intergenic
1159213601 18:65362340-65362362 TTGTGGGGGAGGGGGGAGGGAGG + Intergenic
1159672557 18:71239552-71239574 TAGTGGGTCAGGGCTGCTGGTGG + Intergenic
1159690092 18:71476793-71476815 TTGTGGGATAGGGGGGAGGGGGG + Intergenic
1160505057 18:79422451-79422473 GAGTGGGTGACGGGGGTGGTGGG + Intronic
1160508167 18:79438707-79438729 GCGCGGGTGAGAGGGGCGGGCGG + Intronic
1160691296 19:461579-461601 TCGGGGGTGGGGGGGGGGGGCGG + Intergenic
1160703498 19:518722-518744 TAGAGGGTGAGGAGGAGGGGAGG + Intronic
1160714640 19:570684-570706 GGGTGGGTGGGGGGGGCGGAGGG + Intergenic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160818136 19:1045660-1045682 TGGTGGGGGAGGGGGGCGGGGGG - Intronic
1160824885 19:1074874-1074896 AAGCTGGTGAGGCGGGCGGGCGG + Exonic
1160867505 19:1262377-1262399 TGCTGGGAGAGGAGGGCGGGTGG - Intronic
1160971138 19:1768270-1768292 AAGGAGCTGAGGGGGGCGGGAGG + Intronic
1161400760 19:4065619-4065641 GCGTGGGGGAGGCGGGCGGGCGG - Intronic
1161573898 19:5045129-5045151 CAGTGGGACAGGTGGGCGGGAGG - Intronic
1161590936 19:5128844-5128866 CAGTGGAGGCGGGGGGCGGGGGG + Intronic
1161643108 19:5436489-5436511 TGGTGGGGGAGGGGGAGGGGTGG - Intergenic
1161707180 19:5827694-5827716 CAGTGGGTGCAGGGGGTGGGAGG - Intronic
1161733673 19:5977752-5977774 TCGGGGCTGAAGGGGGCGGGAGG - Intronic
1161762136 19:6181807-6181829 TCGTTGGGGGGGGGGGCGGGTGG - Intronic
1161794409 19:6378185-6378207 TGGTGGGAGAAGGGGGAGGGAGG + Intronic
1161981208 19:7631383-7631405 TGGTGGGAGAGGTGGGCGGGGGG + Intronic
1162087852 19:8259378-8259400 GAGTGGGTGAGGGGGAGGGTAGG + Intronic
1162104592 19:8362817-8362839 TGGTGGGAGGGGGGGGGGGGCGG - Intronic
1162456536 19:10788387-10788409 GAGTGAGTGAGGGGAGTGGGAGG + Intronic
1162533690 19:11250890-11250912 TAGAGGGTGAGCAGGGCCGGGGG + Exonic
1162811845 19:13168870-13168892 TAGAGGCTGAGGCGGGAGGGTGG + Intergenic
1162949435 19:14061908-14061930 TGGGGGGTCAGGGGGGCTGGTGG - Intergenic
1163085683 19:14978169-14978191 TACAGGGTGAGGGGTGAGGGTGG + Intronic
1163093827 19:15041295-15041317 GGGTGGGGGAGGGGGGAGGGAGG - Intergenic
1163110704 19:15159655-15159677 TAGGTGGTGAGGGGAGTGGGGGG + Exonic
1163285143 19:16342107-16342129 TGGTGGGTGCGAGGGGCTGGGGG + Intergenic
1163398046 19:17075627-17075649 TAGTGGGTAGGGGCGGTGGGTGG + Intergenic
1163485571 19:17583419-17583441 TAGTGGGGCGGGGTGGCGGGGGG + Intergenic
1163502692 19:17686299-17686321 GAGTGGGGGGGGGGGGGGGGGGG - Intronic
1163524589 19:17812918-17812940 TACTGGGTGAGGGAGGCTGCTGG - Exonic
1163633738 19:18429231-18429253 AGGCGGGGGAGGGGGGCGGGGGG + Intronic
1163659655 19:18569044-18569066 TAGTGGGTGCGGGGGTGGGCTGG - Exonic
1163800576 19:19362498-19362520 TAGAGGATGAGGCGGGAGGGAGG + Intergenic
1163838613 19:19592050-19592072 GGGTGGGTGAGGGAGGTGGGGGG + Intronic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165803912 19:38568757-38568779 AAGTGGTGGTGGGGGGCGGGGGG + Intronic
1165902398 19:39174891-39174913 CAGTGGTGGAGGGAGGCGGGAGG - Intronic
1166301747 19:41915123-41915145 TAGGGGGTGGGGGCGGGGGGAGG - Intronic
1166559060 19:43719962-43719984 TTGTGGGTGAGGCAGGGGGGCGG - Exonic
1166825989 19:45609541-45609563 GAGGGGGTTATGGGGGCGGGAGG - Intronic
1166876680 19:45901927-45901949 GAGTGGGGGCGGGGGGCGGGCGG + Intronic
1166961584 19:46499849-46499871 TAGTGGTTGCCGGGGGCTGGGGG - Intronic
1166996525 19:46722195-46722217 TAGTGGGTGGGGAGGGCCAGAGG - Intronic
1167436267 19:49480493-49480515 GAGGGGGTGAGGGGGCCGAGAGG + Intronic
1167566634 19:50261308-50261330 GAGGGGGTGATGGGGGAGGGAGG - Intronic
1167603324 19:50466997-50467019 TAGGGAGTGAGGGGGCGGGGAGG + Intronic
1167791914 19:51688542-51688564 CAGTGGGTGGGGGTGGGGGGTGG + Intergenic
1168288946 19:55347721-55347743 AAGGGGCTGAGGGGGGCGGATGG - Exonic
1168557825 19:57358239-57358261 TAGGGGGTGAAGTGGGGGGGGGG - Exonic
925740202 2:6998889-6998911 TTGTGGGGGGTGGGGGCGGGGGG + Intronic
926285145 2:11482499-11482521 TTGTTGGGGAGGAGGGCGGGCGG + Intergenic
926343628 2:11925661-11925683 TAGTGGGTGTTGGGGGAGTGGGG - Intergenic
926773004 2:16394524-16394546 GTGTGGGGGCGGGGGGCGGGGGG - Intergenic
926791121 2:16573031-16573053 TAGTGTGTCAGGGGGCCTGGAGG - Intronic
926919150 2:17922667-17922689 TAGTGGTTGCTGGGGGCTGGGGG - Intronic
927363686 2:22268699-22268721 AAGTGGGTGGGGGGGGGCGGGGG - Intergenic
927472171 2:23385088-23385110 GAGTGGGCGGGGGTGGCGGGTGG - Intergenic
927695527 2:25237079-25237101 TAGTGGCTGCTGGGGGAGGGAGG - Intronic
927868647 2:26609285-26609307 TAGAGGCTGAGGAGGGCAGGGGG + Intronic
928198852 2:29234082-29234104 AAGTGGGTGAGTGGGGTGCGTGG + Intronic
928515185 2:32038406-32038428 TTGAGGGGGGGGGGGGCGGGGGG + Intronic
928983243 2:37157012-37157034 TTGTGCGAGAGGGGGCCGGGCGG - Exonic
929142604 2:38679351-38679373 TAGTGTGTGTCGGGGGCGGTGGG - Intronic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
930043304 2:47146336-47146358 TTGTGGTTGGGTGGGGCGGGGGG - Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
930167204 2:48214666-48214688 TGGTGGGTGGGGGGGTTGGGGGG + Intergenic
930218919 2:48726013-48726035 TGGTGGGGGAGAGGGGTGGGAGG - Intronic
930873507 2:56189837-56189859 TAGTGGGTGAGGGGAAGGAGTGG + Intronic
931123543 2:59248114-59248136 TAGTGGGTGAAGGGTGCAGTTGG - Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931893923 2:66707450-66707472 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
931893927 2:66707454-66707476 TTGTGTGTGGGGGGGGGGGGCGG - Intergenic
932053655 2:68423351-68423373 TAGTGGGGGTGGGGGCAGGGGGG + Intergenic
932072705 2:68636792-68636814 TTGTGTGTGTGTGGGGCGGGGGG + Intergenic
932195114 2:69776504-69776526 TGATGGGTGAGGGGGTGGGGTGG + Intronic
932249366 2:70228958-70228980 ATTTGGGGGAGGGGGGCGGGAGG - Intronic
932356684 2:71073318-71073340 GGGTGGGAGAGGGGGGTGGGAGG - Intronic
932565695 2:72906930-72906952 TGGCGGGGGTGGGGGGCGGGGGG + Intergenic
932791066 2:74654703-74654725 GAGGGGCTGAGGGGCGCGGGAGG - Intronic
933070533 2:77852336-77852358 ATGTGGGTGGGGGGTGCGGGGGG + Intergenic
933131808 2:78681733-78681755 TAGTGGGTGTTGGGGACAGGGGG - Intergenic
933858561 2:86441844-86441866 TGGCGGGGGAGGGCGGCGGGGGG + Intronic
934536693 2:95140128-95140150 CAGTGGGTGAGGGGAGCTGAGGG + Intronic
934654972 2:96112641-96112663 CAATGGGTGAGGGTGGCTGGAGG - Intergenic
934692826 2:96374873-96374895 TAGTGGGTTCTGGGGGTGGGGGG + Intergenic
934971832 2:98770346-98770368 GGGTGGGGGGGGGGGGCGGGGGG - Intergenic
935241251 2:101179861-101179883 CAGTGGGTGAGGTTGGTGGGGGG + Intronic
935563648 2:104584312-104584334 TGGTGGGGGTGGGGGGGGGGCGG + Intergenic
935984539 2:108660102-108660124 GAGTGGGTGAGGTGTGTGGGGGG - Intronic
936086591 2:109473715-109473737 GAGTGGGTGGGGTGGGTGGGTGG - Intronic
936096744 2:109536039-109536061 CAGTGGGTGGGGGTGGGGGGGGG + Intergenic
936136976 2:109903750-109903772 GAGTGGGTGAGGTGTGTGGGGGG - Intergenic
936207721 2:110467735-110467757 GAGTGGGTGAGGTGTGTGGGGGG + Intronic
937039385 2:118809128-118809150 TAGGAGGTGAGGGGGGTGGCAGG - Intergenic
937228496 2:120383497-120383519 TGGTGTGGGTGGGGGGCGGGGGG - Intergenic
938042853 2:128090450-128090472 TGGGGGGTGGGGGGCGCGGGCGG + Intergenic
938492230 2:131767239-131767261 CAGGGGGTGAGGGGGCCAGGGGG + Exonic
938495337 2:131795104-131795126 CAGGGGGTGAGGGGGCCAGGGGG - Exonic
938924337 2:136025314-136025336 TTGAGAGTGAGGGGAGCGGGTGG + Intergenic
938934571 2:136117174-136117196 TACGGGGTGAGGGGCGGGGGCGG - Intronic
939420210 2:141957374-141957396 TTGTGTGTGTGGGGGGGGGGGGG + Intronic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
939618394 2:144386919-144386941 GAGGGGGTGGGGGGGGCAGGGGG - Intergenic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
939939320 2:148330037-148330059 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
940698974 2:157017766-157017788 TGATGGGTGTGGGGGGTGGGGGG + Intergenic
940900821 2:159124859-159124881 TACTTGGTGAGGAGGGCGGGGGG - Intronic
941933253 2:170963483-170963505 GGGCGGGGGAGGGGGGCGGGAGG - Intronic
942303729 2:174586499-174586521 AGGTGGGTGAGGGGGCAGGGCGG + Intronic
942589899 2:177531914-177531936 TACTGGGCGGAGGGGGCGGGGGG + Intronic
942690993 2:178584943-178584965 TGGAGGCTGAGGGGGGCCGGGGG + Exonic
943007681 2:182405618-182405640 TATTGGGTGAAGGGGGCTGCTGG + Intronic
943756610 2:191563678-191563700 TAGTGGGGGTGGGAGGCAGGTGG + Intergenic
944530927 2:200667445-200667467 TGGTGGGGGCGGGGGGTGGGGGG - Intronic
944586252 2:201176275-201176297 TTGCGGGGGGGGGGGGCGGGCGG + Exonic
945100159 2:206256361-206256383 GGGGGGGTGCGGGGGGCGGGTGG - Intergenic
945250877 2:207765892-207765914 TAAAGGGGGAGGGGGGAGGGGGG + Exonic
945585224 2:211653458-211653480 GGGCGGGTGCGGGGGGCGGGGGG - Intronic
945696046 2:213105573-213105595 TAGTGTGTGGGGGGGGAAGGGGG + Intronic
945993177 2:216413143-216413165 TGGTGGGGGAGGGGGGAGGGGGG + Intronic
946328404 2:218996683-218996705 TCATGGGTGAGGGGGTGGGGGGG - Intergenic
946857728 2:223969552-223969574 TAGCGGGGGGGGGGGGGGGGCGG - Intergenic
946926050 2:224627935-224627957 TAGTGGTTGGCGGGGGCTGGGGG - Intergenic
947216561 2:227755283-227755305 GAGTGGGGGAGGGGTGGGGGCGG - Intergenic
947411718 2:229848320-229848342 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
947792490 2:232876162-232876184 TAGGAGGGGCGGGGGGCGGGGGG + Intronic
948072423 2:235138527-235138549 TAGTGGGTGAGCTGGGTGGGAGG + Intergenic
948231278 2:236351302-236351324 AAGTGGGAGAAGTGGGCGGGTGG + Intronic
948519081 2:238524198-238524220 TCCTGGGGGAGTGGGGCGGGTGG + Intergenic
948528661 2:238589133-238589155 TCGTGGGGGCGGGGGGTGGGTGG + Intergenic
948925621 2:241095063-241095085 AGGTGGGTGTGGGGGGGGGGGGG - Exonic
949050358 2:241894566-241894588 TGGTTGGTGGGGGGGGGGGGGGG + Intronic
1169107379 20:3008459-3008481 TAGTGGTTGCTGGGGGAGGGAGG + Intronic
1169208973 20:3755151-3755173 TAGAGGGTTAGGGAGGCAGGAGG + Intronic
1169489756 20:6061445-6061467 TGGTGGGGGGGGGGGGTGGGAGG + Intergenic
1169673726 20:8132190-8132212 TGGCGGGGAAGGGGGGCGGGGGG + Intronic
1169799864 20:9503883-9503905 AAGTGTGTTGGGGGGGCGGGGGG - Intergenic
1170438346 20:16352732-16352754 GAGCGGGTGAGGAGGGCGAGGGG + Intronic
1170907244 20:20527591-20527613 TTGGGGGTGTGGGGGGAGGGCGG - Intronic
1171208953 20:23302426-23302448 GAGTGGGGGCGGGGGGCGGCAGG - Intergenic
1171842354 20:30230150-30230172 TCGTGGGGTAGGGGGGAGGGGGG - Intergenic
1171884229 20:30640167-30640189 TAGGGGGTGAGGAGGGTTGGGGG - Intergenic
1172006196 20:31820306-31820328 GAGAGGGTGACAGGGGCGGGGGG + Exonic
1172232530 20:33346737-33346759 TTGTGGGGGGGGGGGGGGGGGGG + Intergenic
1172233178 20:33350813-33350835 TAGTGGCTTAGTGGGGTGGGTGG - Intergenic
1172296305 20:33813432-33813454 GAGTGGGTGGGGGATGCGGGTGG + Intronic
1172613678 20:36269210-36269232 TGGTGGGGGGGGGGGGCGGGGGG + Intronic
1172807072 20:37619679-37619701 TACTGGGTGTGGGGGGTTGGGGG + Intergenic
1172853796 20:37985493-37985515 CAGTGGGGGAGTGGGGAGGGTGG + Intronic
1172996413 20:39073272-39073294 TTGATGGTGAGGGGGGTGGGTGG - Intergenic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1174030005 20:47616126-47616148 GGGTGGGGGCGGGGGGCGGGTGG - Intronic
1174174520 20:48636442-48636464 TGGTGAGTGAGTGGGGCGGGAGG - Exonic
1174560564 20:51428034-51428056 TAGTGGGTGAGAGGGAAGGAGGG + Intronic
1174863760 20:54116059-54116081 TAGTGGGGGTGGCGGGGGGGCGG - Intergenic
1175032331 20:55968305-55968327 TAGTGGTTGTCGGGGGCTGGGGG - Intergenic
1175158403 20:56989956-56989978 TTGTGTGTGGGGGGGGCGGGGGG + Intergenic
1175346028 20:58276727-58276749 TGGTGGGGGCGGGGGGGGGGGGG + Intergenic
1175442807 20:59002941-59002963 TAGTGAGTGGGAGGGGCCGGGGG - Intronic
1175777694 20:61663510-61663532 GAGTGGGTCAGAGGGGCCGGAGG + Intronic
1175904410 20:62372421-62372443 TAGAGGGTGGGGCGGGTGGGGGG + Intergenic
1176085707 20:63294572-63294594 TAGTAGGAGTGGGGAGCGGGTGG - Intronic
1176088747 20:63309726-63309748 TAGCGGGAGTGGGGGGCAGGTGG - Intronic
1176125540 20:63472999-63473021 GAGTGGGGGAGGGGGAGGGGAGG + Intergenic
1176172430 20:63702001-63702023 TAGTGGGTGACGGGGGGGGGGGG - Intronic
1176180561 20:63747529-63747551 TGGTGGGTGGGGGGGGTGCGGGG + Intronic
1177719999 21:24893489-24893511 TAGTGGGTGGGGGGCTGGGGAGG - Intergenic
1178325861 21:31645033-31645055 TTGTGGGGGAGGGGGCCGAGGGG - Intergenic
1178456045 21:32752443-32752465 GACTGGGTGAGAGGGGAGGGAGG + Intronic
1178479937 21:32971158-32971180 GGGTGGGGGTGGGGGGCGGGGGG - Intergenic
1178580049 21:33830892-33830914 AAGAGGGTGGGGGGGGAGGGAGG + Intronic
1179139621 21:38713077-38713099 TGGGGGGAGGGGGGGGCGGGGGG + Intergenic
1179801946 21:43815278-43815300 AGGTGGGTGGGCGGGGCGGGAGG + Intergenic
1179801965 21:43815332-43815354 AGGTGGGTGGGCGGGGCGGGAGG + Intergenic
1180024973 21:45155881-45155903 TAATGGGTGATGAGGGTGGGTGG - Intronic
1180095980 21:45555426-45555448 TGGGGGGTGTTGGGGGCGGGAGG + Intergenic
1180765058 22:18341394-18341416 TACTGGGTGAGTGGGTCAGGTGG - Intergenic
1180813971 22:18778290-18778312 TACTGGGTGAGTGGGTCAGGTGG + Intergenic
1180818432 22:18807971-18807993 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181160065 22:20954724-20954746 TAGTGGGGGTGGGGGCGGGGAGG - Intergenic
1181200156 22:21212625-21212647 TACTGGGTGAGTGGGTCAGGTGG + Intronic
1181204654 22:21242426-21242448 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181305509 22:21914990-21915012 TAGAGGGTGAGTGGTGGGGGCGG + Intergenic
1181766874 22:25098615-25098637 AACTGGGTGGAGGGGGCGGGGGG + Intronic
1182360600 22:29744366-29744388 TTGTGGGAGGCGGGGGCGGGCGG + Intronic
1183303779 22:37071195-37071217 GAGGGGCTGTGGGGGGCGGGGGG - Intronic
1184139799 22:42571928-42571950 TGTTGGGGGCGGGGGGCGGGGGG + Intronic
1184193731 22:42912353-42912375 TGGTGGGTGATGGGGGCGAGGGG + Intronic
1184430597 22:44439783-44439805 TAGGGGGTGAGGGAGGAAGGAGG - Intergenic
1184691655 22:46120003-46120025 AAGTGGGTGAGGGGAGCGGCTGG - Intergenic
1184736077 22:46398496-46398518 TGGGGGTTGTGGGGGGCGGGGGG - Intronic
1184920226 22:47600681-47600703 CAGAGGCTGAGGGGGGTGGGGGG - Intergenic
1184920309 22:47600997-47601019 CAGAGGCTGAGGGGGGCGGTGGG - Intergenic
1185167462 22:49270318-49270340 AAGTGCATGGGGGGGGCGGGGGG + Intergenic
1185313571 22:50169707-50169729 TACTGGGTGGGGGGGTCGGGTGG + Intergenic
1185408494 22:50671134-50671156 GAGTGAGTGAGAGGGGCCGGGGG + Intergenic
1185413475 22:50697710-50697732 TGAAGGGTGAGGGGCGCGGGGGG + Intergenic
1203222270 22_KI270731v1_random:52989-53011 AAGTGGGGGAGGGGGGCTGATGG - Intergenic
1203226680 22_KI270731v1_random:82299-82321 TACTGGGTGAGTGGGTCAGGTGG - Intergenic
1203264070 22_KI270734v1_random:3977-3999 TACTGGGTGAGTGGGTCAGGTGG + Intergenic
949518786 3:4830847-4830869 TTGAGGGTGAGGGGGGCTTGAGG - Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950845481 3:16011555-16011577 TTGTGTGTGGGGGGGTCGGGGGG + Intergenic
950889150 3:16387716-16387738 GAGTCGGTGAGGCGGGTGGGTGG - Intronic
951217679 3:20040347-20040369 GGGTGGGCGAAGGGGGCGGGAGG + Exonic
951584185 3:24198446-24198468 AAGGGGGGGGGGGGGGCGGGGGG - Intronic
952067800 3:29593011-29593033 GATTGGGGGAGGGGGGAGGGGGG + Intronic
953663169 3:44905771-44905793 TAGGGGGTGAGGGTGGTGGGAGG + Intronic
953891552 3:46755296-46755318 AGGTGGGTGAGGGAGGAGGGTGG - Intronic
953927188 3:46988492-46988514 GAGTGGGGGACGGGGGAGGGAGG - Intronic
954108018 3:48419623-48419645 GGGAGGATGAGGGGGGCGGGAGG + Exonic
954228774 3:49200050-49200072 TAGTGTTTGAGGCGGGCCGGTGG + Intronic
954235555 3:49254562-49254584 GATTGGTTGCGGGGGGCGGGGGG + Intronic
954459234 3:50617094-50617116 GAGTGGGGGAGGGGGGGGTGGGG + Intronic
954798033 3:53171483-53171505 CAGGGAGTGAGGGGGGCTGGAGG - Intronic
955238964 3:57163777-57163799 TAATGGGGCGGGGGGGCGGGGGG + Intronic
955239433 3:57165868-57165890 AGGAGGGTGAGGGGGACGGGGGG - Intronic
955260402 3:57383648-57383670 GAGTTGGGGTGGGGGGCGGGGGG + Intronic
955271590 3:57505248-57505270 TAGTGGGAGAAGTGGGCGGGGGG - Intronic
955309646 3:57872953-57872975 TAGTGGGGCAGGGTAGCGGGGGG - Intronic
955971626 3:64443609-64443631 CGGTGGGGGTGGGGGGCGGGGGG + Intronic
956061619 3:65353745-65353767 AAGTGGGGGAGGGGGGCGGCGGG + Intronic
956600031 3:71010828-71010850 CACTGGGTGGGGGGGGAGGGGGG - Intronic
956609932 3:71112110-71112132 TGGTGGGTGGGGGGGTGGGGGGG + Intronic
956659548 3:71583991-71584013 TCGGGGGGGAGGGGGGAGGGAGG - Intergenic
957103586 3:75858524-75858546 TAATGGTTGATGGGGGAGGGGGG - Intergenic
957194053 3:77045045-77045067 TGTTGGGGGAGGGAGGCGGGCGG + Intronic
957556751 3:81771900-81771922 TGTTGGGTGGGGGGGGGGGGCGG + Intergenic
957686419 3:83507971-83507993 CATTGGGTGGGGGGGGGGGGCGG + Intergenic
957701166 3:83715137-83715159 GTGTGGGTGCGGGGGGTGGGTGG + Intergenic
958875667 3:99613794-99613816 TTGTGTGTGTGGGGGGGGGGCGG - Intergenic
959418821 3:106109502-106109524 TTTGGGGTGAGGGGGGAGGGAGG - Intergenic
960273152 3:115696572-115696594 TTGTGGGGGGGGGGGGCGGTGGG - Intronic
961312042 3:126008637-126008659 GAGAGGCTGAGGGAGGCGGGTGG - Intronic
961359256 3:126357016-126357038 TGGTGGGCGACCGGGGCGGGGGG + Intronic
961663541 3:128482896-128482918 TGGTGAGTGTGGGGGGCTGGGGG + Intronic
962229553 3:133650355-133650377 GTGTGTGTGTGGGGGGCGGGGGG + Intronic
962278640 3:134033837-134033859 CAGTGGGTGATGTGGGCAGGAGG + Intronic
962311876 3:134332568-134332590 TAGGGGGAGAGGAGGTCGGGCGG - Intergenic
962319509 3:134378641-134378663 TTGGGGGTGAGGGGAGGGGGAGG + Intergenic
962514051 3:136132010-136132032 CAGGGGGTGGGGGGGGCTGGGGG + Intronic
962610228 3:137069540-137069562 TAGGGGTTGAGGGGGGTGGTTGG + Intergenic
963498207 3:146095894-146095916 TGGAGGGAGAGGGGGGAGGGGGG - Intronic
963579561 3:147108475-147108497 TTGTGGGTGGGGGAGGGGGGAGG - Intergenic
964389125 3:156179421-156179443 CAGGGGGTGAGGGGGTGGGGGGG - Intronic
964509611 3:157436724-157436746 TGGTGGGGGAGGGGGCTGGGTGG - Intronic
965496128 3:169401314-169401336 AAGTGGGTCAGGGGTGGGGGTGG - Intronic
965521313 3:169670140-169670162 GAATGGGTGAGGGGGGCTTGAGG - Intergenic
965688745 3:171333143-171333165 TAGTTGGTGTTGGGGGTGGGAGG + Intronic
966579108 3:181539554-181539576 TTGAGGGTGAGGGTGGCAGGAGG + Intergenic
966928959 3:184663539-184663561 TATTGGGGGTGGGGGTCGGGAGG - Intronic
967158826 3:186717850-186717872 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158857 3:186717940-186717962 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158878 3:186718000-186718022 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158889 3:186718030-186718052 TGGTGGGTGATGGTGGCGAGTGG - Intronic
967158933 3:186718162-186718184 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158955 3:186718225-186718247 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158972 3:186718269-186718291 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967159025 3:186718411-186718433 TAGTGCGTGATGGTGGTGGGTGG - Intronic
967720185 3:192807951-192807973 TCAAGGGTGAGTGGGGCGGGAGG + Intronic
967921193 3:194615780-194615802 GAGTAGGTGAGTGGGGAGGGGGG - Intronic
968024359 3:195426926-195426948 TGGTGGGGGCGGGTGGCGGGGGG - Intronic
968072627 3:195795837-195795859 AAGTGGGGGAGGGGGGTGGGAGG + Intronic
968082578 3:195856893-195856915 GAGAGGGTGAGCGGGGTGGGCGG + Intergenic
968323448 3:197791535-197791557 GGGCGGGTGAGCGGGGCGGGGGG + Exonic
968475670 4:805928-805950 TGGTGGGTGCGAGGGGCTGGGGG + Intronic
968518250 4:1023727-1023749 CAGGGGGTGACGGGGGTGGGGGG + Intronic
968713449 4:2137621-2137643 TAGTGGGTGAGGGGGGCCACGGG - Intronic
968742119 4:2336556-2336578 TAGGGAGTGGGGGGGGCAGGGGG - Intronic
968908044 4:3463546-3463568 TGGCAGGTGAGCGGGGCGGGCGG + Exonic
968915898 4:3496947-3496969 TAGATGGGGAGGGGGGAGGGTGG + Intronic
969421743 4:7101698-7101720 GGGTGGGTGGGGGGGGGGGGCGG + Intergenic
969718114 4:8878116-8878138 TCCTGGGTGAGGGGGGCAGGCGG - Intergenic
969941334 4:10734872-10734894 AGGTGGGTGGCGGGGGCGGGTGG + Intergenic
970159842 4:13177319-13177341 TGGGGGGTGAGTGGGGTGGGAGG - Intergenic
970533454 4:17005540-17005562 AAGCGGGGGAGGGAGGCGGGGGG - Intergenic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
971109616 4:23570377-23570399 TATTGAGTGAGGGGGTGGGGAGG + Intergenic
972319811 4:37963394-37963416 TGGGGGGTGAGGGAGGGGGGAGG + Intronic
972383907 4:38545144-38545166 TAGTGGGAGAGTGGGGTAGGGGG - Intergenic
973309085 4:48687500-48687522 GGGGGGGTGAGGGGGGAGGGGGG + Intronic
973818848 4:54644646-54644668 TAGTGGGGGAGGTGGGAGGCTGG + Intergenic
974002992 4:56530018-56530040 GAGCGGGGGCGGGGGGCGGGGGG - Intergenic
974827091 4:67144912-67144934 TAGGGGGTGGGGGGAGGGGGAGG + Intergenic
975489504 4:74973457-74973479 GAGGCGGTGAGGGGGGCGGGGGG - Intronic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
976114255 4:81710194-81710216 TGGGGGGTGAGGGGGGAGGTGGG - Intronic
976447025 4:85141789-85141811 TGGGGGGTGGGGGGGGGGGGGGG - Intergenic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977615906 4:99087387-99087409 TGGCGGGGGAGGGGGGGGGGAGG + Intronic
977957374 4:103045610-103045632 TAGTTGGTGGGGGGGTGGGGCGG + Intronic
978503420 4:109433418-109433440 CAGTGGGTGAAGGGACCGGGTGG - Intergenic
979327311 4:119394996-119395018 TCCTGGGTGACGGCGGCGGGAGG + Intergenic
979938055 4:126722373-126722395 GGGTGGGGGGGGGGGGCGGGAGG + Intergenic
980455276 4:133032236-133032258 TTGTTGTTGTGGGGGGCGGGGGG + Intergenic
981041602 4:140227960-140227982 AAGTGGGAGAGGGGGTGGGGAGG - Intergenic
981472714 4:145154834-145154856 TGGTGGTGGTGGGGGGCGGGGGG + Intronic
982155073 4:152511286-152511308 GATTCGGTGGGGGGGGCGGGGGG - Intronic
982467404 4:155747965-155747987 TTGTGGGCGGGGGGGGGGGGGGG - Intergenic
982678315 4:158400773-158400795 AAGTGGGTGAGGGAGGGAGGAGG + Intronic
982722931 4:158877942-158877964 CGGTGGGTGAGGGGGGGTGGGGG - Intronic
983245194 4:165279684-165279706 TCCTGGGTGACGGCGGCGGGAGG + Intronic
983324806 4:166239933-166239955 TAGAGGGGGAGGGTGGGGGGGGG + Intergenic
983353042 4:166618692-166618714 AGGCGGGGGAGGGGGGCGGGGGG + Intergenic
984078852 4:175216836-175216858 TACTCGGTGGGGGGGGGGGGTGG - Intergenic
984615583 4:181893489-181893511 TGGTGGGGGTGGGGGGGGGGTGG - Intergenic
985121196 4:186643789-186643811 AAGTGGGTGGGGGTGGGGGGGGG - Intronic
985451951 4:190067569-190067591 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985451981 4:190067640-190067662 TGGTGGGGGGGGGGGGGGGGGGG - Intergenic
985452938 4:190070860-190070882 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985453927 4:190074153-190074175 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985454915 4:190077446-190077468 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985455901 4:190080743-190080765 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985455931 4:190080814-190080836 TGGTGGGGGGGGGGGGTGGGGGG - Intergenic
985456886 4:190084037-190084059 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985457874 4:190087333-190087355 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985458862 4:190090630-190090652 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985463114 4:190173393-190173415 AAGGGGGAGAGGGGGGAGGGGGG - Intergenic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985545238 5:505771-505793 GAGTGGCTGTGGGGGGTGGGTGG + Intronic
985770510 5:1807265-1807287 TGGTGGTTGCCGGGGGCGGGGGG + Intronic
986739852 5:10696329-10696351 TAGGGGGTGTGGCGGGGGGGAGG + Intronic
987566868 5:19600198-19600220 TCGTGGGTGGGGGAGGGGGGAGG + Intronic
988029124 5:25739507-25739529 TGGTGGGTCAGGAGGGTGGGCGG - Intergenic
988669881 5:33370129-33370151 AAGGGGGTGGGGGGTGCGGGGGG + Intergenic
988987491 5:36635135-36635157 TAGGTGTTGAGGGGGGCAGGTGG - Intronic
990311563 5:54544027-54544049 TAGGGGGTGGGGGGGGCGGTGGG + Intronic
990709599 5:58565169-58565191 GAGTGGGGGGGGGGGGGGGGAGG + Intergenic
990756218 5:59073500-59073522 TGGGGGGCGGGGGGGGCGGGTGG + Intronic
991283621 5:64944047-64944069 AAGTAGGTGATGGGGGCGTGCGG - Intronic
991291245 5:65035555-65035577 TAGTGGCGGCGGGAGGCGGGAGG + Intergenic
991962588 5:72060127-72060149 TAGTGGTTGACAGGGGCTGGGGG + Intergenic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
993229202 5:85210354-85210376 TCGTGGGTTAGGGGGAAGGGGGG - Intergenic
993265482 5:85721612-85721634 TGGGAGGTGGGGGGGGCGGGGGG + Intergenic
993989707 5:94641179-94641201 TTGTGGGGGGGTGGGGCGGGCGG - Intronic
994129539 5:96209645-96209667 GATTGGGTGGGGTGGGCGGGGGG - Intergenic
995729522 5:115223148-115223170 TGGTGGGGGATGGGGGCGGTAGG + Intronic
996223970 5:120967093-120967115 TGAGGGGTGAGTGGGGCGGGGGG + Intergenic
996762922 5:127003976-127003998 GAGTGGCTGAGGGAGGCTGGGGG + Intronic
996936377 5:128953337-128953359 GGGTGGGGGAGGGGGGAGGGGGG + Intronic
998703537 5:144732479-144732501 AAATGGGGCAGGGGGGCGGGGGG - Intergenic
999279453 5:150355472-150355494 ATGTGGGGGGGGGGGGCGGGTGG - Intergenic
999318827 5:150601024-150601046 CAGGGTGTCAGGGGGGCGGGCGG - Intergenic
999586493 5:153095165-153095187 AAGTCGGGGAGGGAGGCGGGCGG + Intergenic
999682667 5:154074575-154074597 AATTGTGTGGGGGGGGCGGGGGG + Intronic
999696423 5:154191436-154191458 TAGGGGTTGTGGGGGGGGGGGGG - Intronic
1000285174 5:159820444-159820466 TGGAGGGTGAGGAGGGCAGGGGG - Intergenic
1000335388 5:160238115-160238137 TAGTGGGAGAGGCAGGCGGGGGG - Intronic
1001288354 5:170439473-170439495 ATGTGGGGGACGGGGGCGGGGGG + Intronic
1001544107 5:172559218-172559240 TGGGGGGTGGAGGGGGCGGGTGG + Intergenic
1001597667 5:172908327-172908349 GAGGGGGGGAGGGGGGAGGGGGG + Intronic
1001868977 5:175133894-175133916 GGGTGGGGGAGGGGGGAGGGGGG - Intergenic
1002073367 5:176693874-176693896 TTCTTGGTGCGGGGGGCGGGGGG + Intergenic
1002190567 5:177475270-177475292 TGGGGGGTGAGGGGAGCGGGGGG - Intergenic
1002278131 5:178116143-178116165 TGGTGGGGGAGGAGGGAGGGAGG - Intronic
1002561118 5:180083047-180083069 TGCTGTGGGAGGGGGGCGGGTGG - Intergenic
1002766557 6:244850-244872 TAGGGGGTGAGGGGAGTAGGAGG + Intergenic
1003020156 6:2502646-2502668 TTGTTGGGGAGGAGGGCGGGTGG + Intergenic
1003176124 6:3752826-3752848 TGGTGGGGGCGGGGGGGGGGTGG - Intergenic
1003226514 6:4210934-4210956 CAGTGGGTGAGGCGGGGGGCGGG - Intergenic
1003278756 6:4674341-4674363 CAGTGGGCGGGGGGGGGGGGGGG + Intergenic
1003421092 6:5959193-5959215 CAGTGGGTGGCGGGGGAGGGGGG + Intergenic
1003873453 6:10418731-10418753 TGGTGGGTGAGGAGGCAGGGGGG - Intronic
1004209293 6:13622031-13622053 TTGTGGGGGAGGGGGGAGAGAGG - Exonic
1004373647 6:15073853-15073875 TATTGGGGGACGGGGGCAGGGGG + Intergenic
1004402172 6:15298993-15299015 TTGCGGGGGTGGGGGGCGGGTGG + Intronic
1004402773 6:15304308-15304330 CAGTGGGTGGGCGGGGGGGGGGG - Intronic
1004409387 6:15366502-15366524 TGGGGGGCGGGGGGGGCGGGGGG + Intronic
1004442035 6:15662961-15662983 TAGTGGGAGTGCGGGGCGCGCGG - Exonic
1004716689 6:18223334-18223356 TGGGGGGGGCGGGGGGCGGGCGG - Exonic
1004989785 6:21124556-21124578 TAGTGGGTAAAGGGAGTGGGAGG - Intronic
1005134949 6:22557274-22557296 TAGTGGGTGGCGGGGGCAGGGGG - Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1005612953 6:27544440-27544462 TGGTTCGTGTGGGGGGCGGGCGG - Intergenic
1005761963 6:28975738-28975760 TAGTGTGTGTCGGTGGCGGGGGG + Intergenic
1005865089 6:29931365-29931387 GAGTTGGTGTGGGGGGAGGGAGG + Intergenic
1006004099 6:30988783-30988805 TGGGGGGGGAGGGGGGAGGGGGG + Exonic
1006116708 6:31779550-31779572 GAGGGGGTGAGGGGGCCTGGAGG + Intronic
1006123490 6:31822101-31822123 GAGTGCGGGGGGGGGGCGGGGGG - Intergenic
1006174555 6:32114155-32114177 TAATGGGTGAGGGCAGTGGGAGG + Intronic
1006305328 6:33215117-33215139 CAGTGGGTGAGGGAGATGGGGGG + Intergenic
1006517704 6:34553908-34553930 TGGCGGGTGCGGGGGCCGGGGGG - Intronic
1006573562 6:35025880-35025902 TAGTGGGGGACTGGGGCTGGCGG - Intronic
1006739961 6:36301111-36301133 TAGTGGGTGGGTGGGGGGGCGGG - Intronic
1007227064 6:40322499-40322521 CAATGGGTGAGGGGGAGGGGAGG - Intergenic
1007378026 6:41469551-41469573 GAGGGGGTGAGGGGTGAGGGAGG + Intergenic
1007719763 6:43878120-43878142 AAGTGGGTCATGGGTGCGGGGGG + Intergenic
1007719768 6:43878127-43878149 TCATGGGTGCGGGGGGTGGGGGG + Intergenic
1007768742 6:44176997-44177019 TGGTGGGTGAGGGGTGAGAGGGG + Exonic
1007948147 6:45844477-45844499 GATTGGGGGCGGGGGGCGGGGGG - Intergenic
1007967381 6:46015420-46015442 TGGTGGGTGAGCCCGGCGGGAGG + Intronic
1008058096 6:46966315-46966337 TAGTGGGTGTGAAGGGCTGGGGG - Intergenic
1008058187 6:46967102-46967124 CAGTGGGCGGGGGGGGGGGGGGG + Intergenic
1008904648 6:56662794-56662816 TAGTTGGGCATGGGGGCGGGGGG + Intronic
1008927557 6:56902904-56902926 TAGAGGGTGGAGGGGGCGGGTGG - Intronic
1009826309 6:68869762-68869784 TTGCAGGGGAGGGGGGCGGGTGG + Intronic
1009900168 6:69800098-69800120 TTGTGGGTGAGGTGGAGGGGTGG - Intergenic
1010643943 6:78364632-78364654 TAGGGGGTGAGGTGGGCTGTAGG - Intergenic
1010779498 6:79929160-79929182 AGGTTGGGGAGGGGGGCGGGTGG + Intronic
1010815805 6:80356950-80356972 TCGTGTGTGTGGGGGGGGGGCGG - Intergenic
1011389403 6:86835661-86835683 TAGTGGGTTAGGTTGGCGGTGGG - Intergenic
1011474425 6:87736896-87736918 GAGGGGGGGAGGGGGGAGGGAGG + Intergenic
1011625738 6:89282181-89282203 TGGTGGAGGAGGGGGGCTGGTGG - Intronic
1011664739 6:89623015-89623037 TGGGGGGTGGGGGGGGCGGGAGG + Intronic
1011741060 6:90361185-90361207 TACTGGGTGAGGGGTGTAGGAGG - Intergenic
1013257030 6:108397598-108397620 TAGTGGGGGATGGGGGAAGGTGG - Intronic
1014180413 6:118378085-118378107 TCGTGGGTGTGGTGCGCGGGAGG + Intergenic
1014194079 6:118532349-118532371 TACTTGATGAGGGGGGCGGGTGG + Intronic
1014913500 6:127119489-127119511 TAGCCGGTGCGAGGGGCGGGCGG + Intronic
1014935479 6:127380473-127380495 TAGTGGGTGGGAGGGGTGGGCGG - Intergenic
1014964375 6:127728725-127728747 TTGGGGGTGAGGTGGCCGGGAGG + Intronic
1015594087 6:134849627-134849649 TTGGGGGGGAGGGGGGAGGGAGG + Intergenic
1015749547 6:136546355-136546377 TAGTGGGGGTAGGGGGTGGGAGG - Intronic
1015994174 6:138980673-138980695 TTGTGGGTGGGGCGGGGGGGGGG + Intronic
1016232726 6:141826465-141826487 TAGGGGTTGTGGGGGGAGGGAGG - Intergenic
1016311188 6:142735270-142735292 TTTTGGGTCGGGGGGGCGGGGGG + Intergenic
1016329683 6:142944359-142944381 TATTTGGTGGGGGGGGGGGGTGG - Intronic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1017717873 6:157224675-157224697 GAGCGGCTGAGGGGGGCCGGCGG + Intergenic
1017761732 6:157574554-157574576 TGCTGGGTGAGGGGAGTGGGAGG - Intronic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1017980560 6:159397726-159397748 TAGTGGGTAAGTGGGTAGGGAGG - Intergenic
1018654671 6:166024161-166024183 TAGGGGGAGAGGGAGGCGGATGG + Intergenic
1018689447 6:166333201-166333223 CAGCGGGTGTGGGGAGCGGGCGG - Intronic
1018702681 6:166439651-166439673 ATGTGGGTGAGGGGGGCTGCTGG + Intronic
1018935927 6:168274075-168274097 TGCTGGGTGCGGGGGGGGGGGGG + Intergenic
1018971187 6:168530644-168530666 CAGTGGGTGTGGGGGCGGGGGGG - Intronic
1018985911 6:168636987-168637009 GAATGAGTGAGGGAGGCGGGAGG - Intronic
1019283674 7:212974-212996 TAGTGCTTGACGGGGGCTGGAGG - Intronic
1019409127 7:899016-899038 ACGCAGGTGAGGGGGGCGGGCGG - Exonic
1019471110 7:1221539-1221561 TAGTGGTTGCCGGGGGCTGGGGG + Intergenic
1019511247 7:1418726-1418748 TGGGGGGTGGGGGGGGGGGGTGG - Intergenic
1019548860 7:1592373-1592395 GAGTGGGTGGTGGGGCCGGGCGG + Intergenic
1019572784 7:1720731-1720753 TACTAGGTGCGGGGGGTGGGGGG - Intronic
1019587932 7:1814953-1814975 TGGTGGGCGGGGGGGGGGGGGGG + Intergenic
1019804461 7:3113065-3113087 TAGTGGGTGAGGAGTGGGAGAGG + Intergenic
1020084778 7:5304295-5304317 GAAGGGGTGGGGGGGGCGGGCGG - Exonic
1020274122 7:6614905-6614927 GAGAGGGTGAGGGAGGTGGGAGG + Intergenic
1021116896 7:16754287-16754309 CGGTGGGTGAGGGGGCGGGGTGG - Intronic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1021153364 7:17179331-17179353 TGGTGTGTGTGGGGGGTGGGGGG - Intergenic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021943574 7:25703642-25703664 GGGTGGGGGAGGGGGGAGGGGGG + Intergenic
1022388912 7:29926740-29926762 TGGTGGGTGTGGGTGACGGGTGG + Intronic
1022459729 7:30594119-30594141 AACTGGGTGTGTGGGGCGGGGGG + Intergenic
1023000170 7:35800734-35800756 TAGTGGGTGGGGTGCGAGGGTGG - Intergenic
1023778530 7:43634340-43634362 AAGTGGGTGACGGGGGCATGTGG + Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1024458235 7:49632782-49632804 AGGTGGGTGAGGGAGGTGGGTGG - Intergenic
1024529051 7:50375703-50375725 TGGTGGGTGGGGGGGGGGGGTGG - Intronic
1025065937 7:55856143-55856165 TAGAGGGTGAGGGAGGGAGGGGG - Intronic
1025604524 7:63029818-63029840 TGGTGGCTGGGGGGGTCGGGGGG + Intergenic
1026939148 7:74276881-74276903 AGGTGGGTGAAGGGGGCGGTGGG - Intergenic
1027189640 7:75989316-75989338 CAGCGGGTGAGGGGGTGGGGTGG - Intronic
1027288719 7:76678249-76678271 CAGTGGCTGAGGGGAGCAGGAGG + Intergenic
1027374893 7:77538535-77538557 TAGGGGGTGGCGGAGGCGGGGGG - Intronic
1027741731 7:82016604-82016626 TTTTGGGGGGGGGGGGCGGGCGG - Intronic
1028212801 7:88095918-88095940 AAGGGGGGGTGGGGGGCGGGTGG - Intronic
1028551714 7:92074860-92074882 TAGGGGGTGAGGGGTACAGGAGG + Intronic
1028986790 7:97015757-97015779 AAGTGGGTGAGGGTGAAGGGTGG - Intergenic
1029001747 7:97161578-97161600 CAGAGGGTGAGGGGGGCTAGGGG - Intronic
1029080959 7:97973523-97973545 CAGGCGGAGAGGGGGGCGGGGGG - Intergenic
1029259401 7:99291621-99291643 TTGGGGGTGGGGGGGGTGGGGGG - Intergenic
1029349976 7:100006330-100006352 GAGAGGCTGAGGTGGGCGGGCGG - Intergenic
1029414735 7:100435831-100435853 CCGAGGGTGAGGGGGGCGGGCGG - Exonic
1029433256 7:100546163-100546185 TGGTGGGGGTGGCGGGCGGGGGG - Intronic
1029457008 7:100676397-100676419 TGGTGGGGGAAGGGGGAGGGAGG + Intronic
1029478764 7:100800696-100800718 TATTGGGTGACTGAGGCGGGAGG + Intergenic
1029540325 7:101179062-101179084 TGGTGGGAGTGGGGTGCGGGTGG - Intronic
1030120087 7:106101449-106101471 TTGTGGGGGGGGGGGGGGGGGGG - Intronic
1030491240 7:110237516-110237538 TATTGGGGGGGGGGGGAGGGGGG + Intergenic
1030927538 7:115477062-115477084 TAGTGTGTGGGGGGGTGGGGTGG + Intergenic
1031525117 7:122816170-122816192 TAGTGGGTAAGGGGTGGGTGGGG - Intronic
1031972496 7:128074724-128074746 TAGTGTGTGAGGAGGACGGGAGG - Intronic
1032020823 7:128406304-128406326 TCGGGGGTGGGGGGGGTGGGGGG - Intronic
1032084008 7:128874271-128874293 GAGTGGGTGAGGGGGCACGGCGG - Intronic
1032279710 7:130491046-130491068 GAGCGGGTGAGCGGGGCGGCCGG - Intronic
1032405359 7:131651952-131651974 TTGGGGGTCAGGGAGGCGGGAGG - Intergenic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1032735879 7:134692267-134692289 TGGTGGGTGAGGGGTGGGGTGGG - Intergenic
1032916449 7:136495407-136495429 TAGTGGGGGGGGGGGGGGGGTGG - Intergenic
1033168000 7:139058150-139058172 TAGTGGGGGAGGGTGGGGGGTGG - Intronic
1033178366 7:139148812-139148834 TGGGGGGTTCGGGGGGCGGGTGG + Intronic
1034129979 7:148706670-148706692 TTGGGGGTGGGGGCGGCGGGGGG + Intronic
1034423280 7:151000134-151000156 GGGTGGGTGAGGGGGGCATGGGG + Intronic
1034535852 7:151725222-151725244 TCGTGTGTGTGGGTGGCGGGTGG - Intronic
1034588030 7:152113538-152113560 TACTAGGTGAAGGGGGTGGGGGG - Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1034865133 7:154635269-154635291 AAGTGGGTGGTGGGGGTGGGTGG - Intronic
1034875500 7:154721321-154721343 TGGTGGGTCAGGGGTGCGGCTGG - Intronic
1035413782 7:158667367-158667389 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413854 7:158667569-158667591 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413913 7:158667741-158667763 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413924 7:158667771-158667793 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413945 7:158667830-158667852 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414014 7:158668032-158668054 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414074 7:158668204-158668226 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035587276 8:785866-785888 CAGCGGGTGAGGGAGGAGGGAGG - Intergenic
1035761511 8:2072228-2072250 TTTTGGGGGCGGGGGGCGGGGGG - Intronic
1037092912 8:14945158-14945180 GGGTGGGTGGGGGGGGTGGGCGG + Intronic
1037101466 8:15052386-15052408 AAGTGAGTGAGGGTGGTGGGTGG + Intronic
1037548532 8:19947661-19947683 TTGTGTGTGTGTGGGGCGGGGGG - Intronic
1037880982 8:22573233-22573255 TAGTGGGGGAGGGAGGGAGGCGG + Intronic
1038103014 8:24400780-24400802 TTGTGGGTGGGGGGAGGGGGAGG - Intronic
1038490551 8:27967502-27967524 CACTGGGTGGGGGCGGCGGGGGG + Intronic
1039154518 8:34540415-34540437 TCCTGGGTGAGGGAGGGGGGAGG - Intergenic
1039468767 8:37801138-37801160 TAATGGGTGGAGGTGGCGGGAGG - Intronic
1039592584 8:38762289-38762311 TGGTGGGTGCCGGGGGCTGGGGG - Intronic
1039884354 8:41646866-41646888 TGGTGGGGGCGGGGGGCGGAGGG - Intronic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1040471090 8:47736772-47736794 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1041054900 8:53974523-53974545 TAGTGGGGGTGGGGGTGGGGGGG + Intronic
1041163868 8:55072292-55072314 CAGGGGGTCAGGGGGGGGGGTGG + Intergenic
1041204558 8:55485609-55485631 TGGAGGCTGAGGGGGGCAGGAGG - Intronic
1041345162 8:56889408-56889430 TAGTGGATGAGGGAAGTGGGTGG + Intergenic
1041495576 8:58482097-58482119 TAGGTGGTGGGGGGGGTGGGTGG - Intergenic
1041923820 8:63215210-63215232 TGGGGGGTGGGGGGGGGGGGAGG - Intergenic
1042170355 8:65985300-65985322 TGGTGGGGGTGGGGGGTGGGAGG + Intergenic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042499392 8:69492041-69492063 GAGTAGGTGAGGCGGGAGGGCGG + Intronic
1042914787 8:73864747-73864769 TTTTGGGGGGGGGGGGCGGGGGG + Intronic
1043805657 8:84669481-84669503 GAGTGGGGGGGGGGGGAGGGGGG - Intronic
1043868571 8:85403264-85403286 TTGTGGGTGAGGGGTGGGGCTGG + Intronic
1043972947 8:86552964-86552986 TTGTGGGCGGGGGGGGGGGGGGG - Intronic
1044727934 8:95208180-95208202 GTGTGGGGGAGGGGGGGGGGCGG + Intergenic
1045320936 8:101080856-101080878 TCGTGGGGGAGGGGCGCGTGGGG - Intergenic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045737801 8:105317999-105318021 TTGGGGGTGAGGGGAGGGGGCGG + Intronic
1045995249 8:108354261-108354283 TAGTGAGTGAGGGAGGGGGCAGG + Intronic
1046766911 8:118079657-118079679 TAGTGGGTGGGGTGGGGGTGGGG - Intronic
1046880051 8:119298028-119298050 TTGTGGGTGTGGGGAGGGGGAGG + Intergenic
1047761927 8:127960936-127960958 TTGGGGGTGGGGGGGGCGGGCGG + Intergenic
1049184900 8:141244950-141244972 ACGTGGGTGGGGGGGGGGGGCGG + Intronic
1049368847 8:142253866-142253888 CAGTGGGTGAGGGAGGTGGGAGG + Intronic
1049502482 8:142974822-142974844 TGGTCTGTGCGGGGGGCGGGGGG - Intergenic
1049674858 8:143884904-143884926 TGGTGAGTGAGGGGGGCAGATGG - Intergenic
1049836975 8:144742471-144742493 TAGTGGGGGAGGTGTGTGGGGGG - Intronic
1050160248 9:2711379-2711401 TGGTGGGGGGGGGGGGTGGGGGG + Intergenic
1050531277 9:6591829-6591851 TGGGAGGTCAGGGGGGCGGGGGG - Intronic
1050653569 9:7799547-7799569 TTGGGGCTGATGGGGGCGGGCGG - Exonic
1051223852 9:14878322-14878344 TAGTGGGGGAGAGAGGAGGGAGG - Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1051387544 9:16525067-16525089 GAGTGGGGGAGGGGGGGGGAAGG + Intronic
1051491565 9:17672631-17672653 TATTGGGTGAAGGGGGTGGGTGG - Intronic
1051515155 9:17922531-17922553 ATGTGGGTGAGGGGGAAGGGTGG - Intergenic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1053123236 9:35561115-35561137 GAAGGGCTGAGGGGGGCGGGGGG + Intronic
1053157701 9:35792028-35792050 GGGTGGGGGTGGGGGGCGGGTGG - Intergenic
1053203353 9:36167113-36167135 TGGGGGGTGAGGGGGGTTGGGGG + Intergenic
1053360959 9:37486355-37486377 TGGTGGGTGAGGGGGTCAGCAGG - Intronic
1054374951 9:64442448-64442470 CAGTGGGAGATGGGGGTGGGAGG + Intergenic
1054521791 9:66080060-66080082 CAGTGGGAGATGGGGGTGGGAGG - Intergenic
1055240629 9:74182158-74182180 TAGTGGTTGACTGGGGCTGGTGG + Intergenic
1056073547 9:83014862-83014884 TAGTGGGTGGAGGGGAAGGGAGG - Intronic
1056471735 9:86911286-86911308 TAGTGAGAGAGAGGGGCGGGGGG + Intergenic
1057231895 9:93326083-93326105 GAGTGGGGGAGGGGAGGGGGCGG + Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057443157 9:95096428-95096450 TGGTGGGTGCGGGAGGTGGGTGG + Intergenic
1057499092 9:95582595-95582617 AAATGGGTGAGGGGGGATGGGGG + Intergenic
1057551136 9:96051452-96051474 GGGGGGGTGAAGGGGGCGGGGGG + Intergenic
1058023713 9:100117603-100117625 AGGTGGGCGGGGGGGGCGGGGGG - Intronic
1058640322 9:107077690-107077712 AAGTGGGAGAGGGGGACTGGGGG - Intergenic
1059053274 9:110952384-110952406 TAGAGGGTGAGGGGGAAGGTGGG - Intronic
1059393476 9:114016223-114016245 TAGTGGGTGGGGGGTGCTTGGGG + Intronic
1059394352 9:114024728-114024750 TAATGGGGGATGGGGGTGGGGGG - Intronic
1059466473 9:114471853-114471875 GAGTGGGTGAAGGGAGCAGGAGG - Intronic
1059480562 9:114586262-114586284 TAGTGGGGGATGGAGGCGGTGGG - Intergenic
1059507076 9:114809198-114809220 CAGTGGGTGAGGGGGAGTGGGGG + Intergenic
1059865790 9:118512630-118512652 TAGTGGGTGATGGGGGCTGCTGG - Intergenic
1059887892 9:118767526-118767548 TAGTGGGTAATGGAGGTGGGGGG - Intergenic
1059940426 9:119353971-119353993 TAGTGGGTCAAGGGAGAGGGAGG - Intronic
1060283265 9:122227950-122227972 GAGTGGGGTGGGGGGGCGGGTGG - Intronic
1060664572 9:125425044-125425066 TGGTGGGGGCGGGGGGGGGGCGG - Intergenic
1060788025 9:126465665-126465687 TGGTGGGGGCGGGGGGTGGGGGG + Intronic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1061191897 9:129086999-129087021 TAGTGGGTGGGGGAGCAGGGTGG + Intronic
1061246002 9:129401569-129401591 TAGTGGGGCAAGGGGGTGGGAGG + Intergenic
1061255992 9:129454350-129454372 TGGTGGGTGAAGGTGGTGGGTGG + Intergenic
1061936605 9:133861192-133861214 GAAGGGGTGTGGGGGGCGGGAGG - Intronic
1062046185 9:134425556-134425578 GGGGGGGTGAGGGGGGTGGGGGG + Intronic
1062466301 9:136683060-136683082 TAGGGGGTGGGGGGGAGGGGGGG + Intronic
1062534607 9:137015941-137015963 AAGTGGGTGGGCTGGGCGGGGGG - Exonic
1062541372 9:137043151-137043173 CGGGGGGTGACGGGGGCGGGTGG - Intronic
1062559137 9:137131694-137131716 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
1062689458 9:137833932-137833954 CAGGGGCTGAGGGGGTCGGGAGG - Intronic
1185473225 X:397634-397656 TGGAGGGTGTGGGGGGCAGGAGG - Intergenic
1185575586 X:1169333-1169355 AAGTGGGGGAGGGGGAAGGGAGG + Intergenic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186202651 X:7169886-7169908 TTGTTGGTGGGGGGGGCTGGGGG + Intergenic
1186451144 X:9674686-9674708 TACTGGGGGGGGGGGGGGGGGGG - Intronic
1186802373 X:13106115-13106137 TGGGGGGCGGGGGGGGCGGGGGG - Intergenic
1186878160 X:13837703-13837725 AAGTTGGTGGGGGGGGGGGGGGG + Intronic
1187007480 X:15246810-15246832 CACTGGGTGAGGGGGGATGGGGG + Intronic
1187362311 X:18640432-18640454 TTGGGGGTGGGGGGGGGGGGTGG - Exonic
1187441215 X:19321944-19321966 GGGTGGGTGGGGGGGACGGGGGG + Intergenic
1188002387 X:24994755-24994777 TTGGGGGTGGGGGGGGCGCGGGG + Intronic
1188483000 X:30653477-30653499 TCCTGGGTGACGGCGGCGGGAGG - Exonic
1188542445 X:31265774-31265796 TTGGGGGTGTGGGGGGGGGGGGG + Intronic
1188851764 X:35140829-35140851 TGGGGGGGGAGGGGGGAGGGGGG + Intergenic
1189065658 X:37805705-37805727 TATTGGGTGAGTGGAGGGGGTGG - Intronic
1189068962 X:37844514-37844536 TATTGAGAGAAGGGGGCGGGTGG - Intronic
1189310683 X:40015114-40015136 TGCCGGGAGAGGGGGGCGGGAGG + Intergenic
1189365246 X:40383210-40383232 TGGTGGGGGTGGGGGGTGGGCGG + Intergenic
1189474044 X:41335061-41335083 GAGTGGGGGAGGGGTGGGGGCGG + Intronic
1189834455 X:45005963-45005985 TGGGGGGTGGGGGGGGTGGGGGG - Intronic
1189864969 X:45318286-45318308 TAGTGGGTGAGTTGGGGAGGTGG + Intergenic
1190300299 X:49053557-49053579 TAGAGGGTGGGGGGACCGGGGGG - Intronic
1190392123 X:49942548-49942570 TCGTGGGGTAGGGGGGAGGGGGG - Intronic
1190417131 X:50191188-50191210 TAGGGGTTGAGGGGGTTGGGTGG - Intronic
1190475216 X:50820495-50820517 TGGCGGGGGCGGGGGGCGGGGGG - Intergenic
1190604686 X:52128613-52128635 GTGTGGGGGAGTGGGGCGGGGGG - Intergenic
1190741031 X:53288960-53288982 CAGTTGGTGATGGGGGTGGGGGG - Intronic
1191641636 X:63433598-63433620 GAGTGGGGCTGGGGGGCGGGTGG + Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191858666 X:65648128-65648150 GAGGGGGTGGGGGGGGCGTGAGG + Intronic
1192180759 X:68914353-68914375 GTGTGGGGGAGGGGAGCGGGAGG - Intergenic
1192337575 X:70234978-70235000 TAGTGGGAGGGGGCGGGGGGTGG + Intronic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1195123427 X:101780579-101780601 TCCTGGGTGACGGCGGCGGGAGG + Intergenic
1195410873 X:104566909-104566931 GAGTGGCTGAAGGGGGCGCGAGG - Exonic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1195654204 X:107319650-107319672 TAGTGTGTGTGTGGGGGGGGGGG + Intergenic
1195910052 X:109880379-109880401 TAGAGTGTGAGGTGGGAGGGAGG - Intergenic
1196697829 X:118632974-118632996 GGGGGGGTGAGGGGGGTGGGGGG + Intronic
1198001543 X:132443991-132444013 AAGTAGGTGGGGGGGGGGGGGGG - Intronic
1198177825 X:134173029-134173051 TAGTGGGTGAAGAGGGCGCCTGG - Intergenic
1198201799 X:134428291-134428313 TCCTGGGGGAGGGGGGCAGGGGG + Exonic
1198233496 X:134715447-134715469 CAGTGTGTTAGGGGGGTGGGGGG - Intronic
1198509573 X:137336595-137336617 TAGTGGGAAAGGGGGGATGGTGG + Intergenic
1198531238 X:137550893-137550915 GTGCGGGTTAGGGGGGCGGGGGG - Intergenic
1198575305 X:138004191-138004213 TAGAGGGTGAGGGGTAGGGGTGG + Intergenic
1199754626 X:150852625-150852647 TAGTGGTTGCTGGGGGCTGGGGG - Intronic
1199832971 X:151562849-151562871 TCGGGGGTCGGGGGGGCGGGGGG + Intergenic
1199832976 X:151562856-151562878 TCGGGGGGGCGGGGGGCGGGGGG + Intergenic
1200087238 X:153613208-153613230 CAGGGGGTGAGGAGGGGGGGGGG + Intergenic
1200133785 X:153864975-153864997 CAGTGGATGAGGGGGGCAAGGGG - Exonic
1200182765 X:154160963-154160985 TAGTGGGTGCCAGGGGCTGGGGG + Intergenic
1200188419 X:154198077-154198099 TAGTGGGTGCCAGGGGCTGGGGG + Intergenic
1200194069 X:154235217-154235239 TAGTGGGTGCCAGGGGCTGGGGG + Intergenic
1200199824 X:154273021-154273043 TAGTGGGTGCCAGGGGCTGGGGG + Intronic
1200292398 X:154885955-154885977 TAGTCGGGGCGGGGGGGGGGGGG + Intronic
1200339236 X:155381692-155381714 TAGTCGGGGCGGGGGGGGGGGGG + Intergenic
1200347233 X:155459000-155459022 TAGTCGGGGCGGGGGGGGGGGGG - Intergenic
1200860089 Y:7982244-7982266 GTGTGTGTGTGGGGGGCGGGGGG - Intergenic
1201252193 Y:12070541-12070563 TATTGGGTGTGGGGGGTTGGGGG - Intergenic
1201699494 Y:16864752-16864774 TTGTGGGTGGGGGAGGGGGGAGG + Intergenic
1201811919 Y:18080586-18080608 GAGCGGGTGGGGGGGGGGGGCGG + Intergenic