ID: 949714485

View in Genome Browser
Species Human (GRCh38)
Location 3:6913482-6913504
Sequence TGGTAAGTATTTTCACATAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949714485_949714490 29 Left 949714485 3:6913482-6913504 CCGTTATGTGAAAATACTTACCA 0: 1
1: 0
2: 4
3: 16
4: 238
Right 949714490 3:6913534-6913556 TCTTATCTTTTTCTAGTTCTTGG 0: 1
1: 0
2: 11
3: 101
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949714485 Original CRISPR TGGTAAGTATTTTCACATAA CGG (reversed) Intronic
901371737 1:8804646-8804668 TGGAAAGTATCTTCACAAGAAGG + Intronic
904391041 1:30186302-30186324 TGATAATTATCTTCAGATAATGG - Intergenic
907913585 1:58848649-58848671 TGTTTAGTAGTTGCACATAAGGG + Intergenic
908805596 1:67928013-67928035 TGTTAAGTTTTTTAAAATAAAGG - Intergenic
909764221 1:79334542-79334564 TGCTAAATATTTTTACATCAGGG - Intergenic
909954439 1:81761595-81761617 TGATAAGTACTTTCAAATACAGG - Intronic
910611302 1:89145263-89145285 TTTTAAATAATTTCACATAAAGG + Intronic
912283216 1:108339860-108339882 TGATAACCATTTTTACATAAAGG - Intergenic
914928709 1:151910360-151910382 TGGTAAGCATTTAAAAATAAAGG - Intergenic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
917337333 1:173939181-173939203 TAGTAAGTATTTTAAGATACGGG - Intronic
918980234 1:191547982-191548004 GGGAATGTATTTTCAAATAAAGG - Intergenic
921766719 1:218981312-218981334 TGTTAAGTTTTTTGACATTAGGG + Intergenic
922818431 1:228467913-228467935 TGGTCAGCATTTGCACAGAAAGG + Intergenic
922915753 1:229256266-229256288 TGGTGAGTATTTTTACAATATGG - Intergenic
1064918883 10:20493643-20493665 TGGTAAGAATTTTTAGAAAATGG - Intergenic
1066773375 10:38865343-38865365 TGGAAATTATTTGCACAGAATGG + Intergenic
1067073669 10:43158574-43158596 GGATAAGTATTTTCACAAATAGG + Intronic
1068206572 10:53862654-53862676 TGGTAGGCATTTACACAAAATGG - Intronic
1068817193 10:61330727-61330749 TGAAAAGTATTTTCACATGTGGG - Intergenic
1069216662 10:65829923-65829945 TAGTATGTATTTTCAAATTAGGG + Intergenic
1072433030 10:95390372-95390394 GGGAAAATATTTTCAAATAATGG - Intronic
1073005772 10:100323121-100323143 GGGAAAGTACTTTCACTTAAAGG + Intronic
1074091340 10:110260823-110260845 TGGTAAGTAGTTTTCCAAAAGGG - Intronic
1078868653 11:15323611-15323633 TGGTAAGTATTTCAACTTCATGG - Intergenic
1079376438 11:19896230-19896252 TGTTAAGTATATTCACATTGTGG + Intronic
1081325582 11:41739821-41739843 TGGGAAGTATTTTCTCACAAAGG + Intergenic
1085838415 11:79981563-79981585 TGGGAAGCATTTTTACGTAAAGG + Intergenic
1087245466 11:95830627-95830649 TGGGAAGGATTTTCACAAATGGG - Intronic
1087490859 11:98825327-98825349 TGGTAAATATGATAACATAAAGG - Intergenic
1087862644 11:103180340-103180362 TGGAAAATACTTTCACATAGAGG + Intronic
1088042415 11:105403438-105403460 TGCTCAGTATTTTAACACAATGG + Intergenic
1088405981 11:109479533-109479555 TAGGAAGTATTTTCAGATACAGG + Intergenic
1089941053 11:122418106-122418128 TGGTCAGTTTTTACACAGAAAGG - Intergenic
1091248463 11:134120758-134120780 TGCTAAGAGTTTTCACATAATGG - Intronic
1093834791 12:23815583-23815605 AAGTAATTATTTTCAAATAAAGG + Intronic
1094043202 12:26139399-26139421 AGGTAATAATTTTCACATACTGG + Intronic
1094340116 12:29401685-29401707 TGGCAAGTTTTTACACAGAAAGG - Intergenic
1095833017 12:46607828-46607850 TTGTAAGGATTTTGAAATAATGG - Intergenic
1097918023 12:65040477-65040499 TGGCAAGTAGTATCTCATAATGG + Intergenic
1098993012 12:77086321-77086343 TGGTAATTATTTTCAACAAATGG + Intergenic
1099405070 12:82249342-82249364 GGGTAATGATTTTAACATAAAGG + Intronic
1100773902 12:97953826-97953848 TGTACAGTATTCTCACATAAGGG - Intergenic
1100819020 12:98413834-98413856 TGGTATGTGTTTTCTCATTACGG + Intergenic
1103809248 12:123600910-123600932 TGGCCAGTTTTTTCACAGAAAGG + Intergenic
1105621255 13:22068903-22068925 TAGAAAGTCTTTTCCCATAAAGG - Intergenic
1106651356 13:31693582-31693604 AGGTCAGGAGTTTCACATAATGG - Intergenic
1107092610 13:36498428-36498450 TGGTAAGTCTTTTCCCAAATGGG - Intergenic
1107250785 13:38359417-38359439 TTGACAGTATTTTAACATAATGG + Intronic
1107567832 13:41624626-41624648 TGTTAAGGGTTTTAACATAAAGG - Intronic
1108005781 13:45944852-45944874 TGGAATGTTTTTTAACATAATGG + Intergenic
1109762714 13:66850675-66850697 TGGAATATATTTTCACATCAAGG - Intronic
1110221155 13:73075559-73075581 TGATATGTATTTACTCATAATGG + Intronic
1110748519 13:79084989-79085011 TGTTAATTATTTTCACATAATGG - Intergenic
1110871842 13:80461550-80461572 TGGTAAGTTTTTACACAGAAAGG - Intergenic
1111001286 13:82186466-82186488 TGGTAATTATTTCCACTTTAAGG - Intergenic
1111203539 13:84972793-84972815 TGGTAAGGAATTTAAGATAACGG - Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1115925807 14:38432547-38432569 TGGTGTGTATTTTTAAATAATGG - Intergenic
1116705555 14:48294169-48294191 AGGATAGTATTTTCAAATAATGG - Intergenic
1116705907 14:48299630-48299652 TGGTAAAATTTTTTACATAAAGG + Intergenic
1116732968 14:48648527-48648549 TGGTCAGAATATTCAAATAAAGG - Intergenic
1119056985 14:71432500-71432522 TGGCCAGTATTTACACAGAAAGG + Intronic
1120020526 14:79525045-79525067 TGGTCAGTTTTTACACAGAAAGG + Intronic
1125106994 15:35983317-35983339 TGGTGAATATTTTCCCAAAATGG + Intergenic
1126360507 15:47840913-47840935 CTGAAAGTATTTTCACAGAATGG + Intergenic
1127044293 15:55009768-55009790 TGGTAAGTATTATGAGATAAGGG - Intergenic
1128397188 15:67240022-67240044 TGCTAAGTATTGTAACATCACGG - Intronic
1130736557 15:86556540-86556562 TGGTGAGTAATTTTACATATGGG + Intronic
1131701416 15:94940845-94940867 TGAAAAGTATTTTCACCTGAAGG - Intergenic
1132325312 15:100964021-100964043 TGGTGAGTATATCCACAAAATGG + Intronic
1133958072 16:10464577-10464599 TTGGAAGTAATTGCACATAAAGG - Intronic
1134858665 16:17541375-17541397 AGGTAAATATTTGCAAATAAAGG + Intergenic
1135286454 16:21197647-21197669 TCTTAAGTATTTTTAAATAAGGG + Intronic
1135832676 16:25790065-25790087 TGTTGAGTATATTCACATAGTGG + Intronic
1145873167 17:28293560-28293582 TGTTAAGTATATTCACATGTTGG - Intergenic
1148019515 17:44543948-44543970 TGGTAAGTGACTTCACATAGTGG - Intergenic
1149223574 17:54442590-54442612 TGGGAAGTCGTTTCAAATAAAGG - Intergenic
1150279776 17:63922755-63922777 TGCTAAGTAATTTCACATTGGGG + Intergenic
1150957678 17:69878636-69878658 TTTTTAGTATTTTCACAAAATGG - Intergenic
1150999326 17:70355620-70355642 ATGTAATTATTTTCATATAATGG - Intergenic
1153261197 18:3226030-3226052 CCATCAGTATTTTCACATAATGG + Intergenic
1157878587 18:51296780-51296802 TAGTAAGTATTTGGACAAAAAGG - Intergenic
1158573426 18:58615866-58615888 TTGTCAGTATTTTCACATGTGGG - Intronic
1159145341 18:64446997-64447019 TGGTAAGTATTTGAAGAAAAAGG + Intergenic
1166443542 19:42837978-42838000 TAGAAAGCATTTTCAAATAAGGG - Intronic
1166463233 19:43008639-43008661 TAGAAAGCATTTTCAAATAAGGG - Intronic
1166469377 19:43065198-43065220 TAGAAAGCATTTTCAAATAAGGG - Intronic
1167193279 19:48007143-48007165 TGAAAAGCATTTTCACATCAAGG + Intronic
926517016 2:13859715-13859737 AGGTAAGGATTTTGACACAAAGG + Intergenic
927017791 2:18984628-18984650 TGTTCAGTATATTCACATTATGG + Intergenic
928073778 2:28243983-28244005 TGGTTAGTATTGTCACATTATGG + Intronic
928561789 2:32496139-32496161 AGGAAAGTATTTTCAAAAAATGG - Intronic
928749054 2:34449940-34449962 TGGTAAGGATGTGCAGATAAAGG - Intergenic
929238598 2:39630241-39630263 TGGAAAGTAATTCCAAATAATGG + Intergenic
932076734 2:68671421-68671443 TGGTAAGTATTGTGAAAAAAAGG + Intergenic
932679556 2:73813027-73813049 TGGTAATGATATTAACATAATGG + Intronic
933450812 2:82447985-82448007 TTGTTAGAATTTTCACTTAAAGG + Intergenic
936818959 2:116495178-116495200 TGATTATTATTTTCACATAGAGG + Intergenic
939216978 2:139251021-139251043 TGGTAAGTGTTTGCACATTATGG - Intergenic
939431801 2:142119187-142119209 TGGTATGTTTTTACACTTAAGGG - Intronic
939925329 2:148166647-148166669 CTTTAAGTATTTTCACATGAGGG + Intronic
939940806 2:148348442-148348464 TATTCAGTATTTTCAAATAAAGG + Intronic
940361493 2:152800690-152800712 TAATAAGTATTTTCAATTAAAGG + Intergenic
941354695 2:164475666-164475688 TGGCAATTCTTTTCACACAAAGG - Intergenic
941857982 2:170249768-170249790 TGGAAAGCATTTTCATTTAAAGG + Intronic
942491344 2:176492565-176492587 TGATAAATATTTTAACAAAAAGG - Intergenic
942820245 2:180105143-180105165 TGGAAATTATTTTTACATAGAGG + Intergenic
942913244 2:181271725-181271747 TGGTTATTGTTTTCACACAATGG + Intergenic
943678133 2:190737332-190737354 TGGGAAGTATTTTTCTATAAAGG + Intergenic
944354200 2:198766372-198766394 TGCTACATATTTTCACGTAAAGG + Intergenic
944508056 2:200435271-200435293 TGGTAAGTGTTTTCAATAAAAGG + Intronic
945470890 2:210226526-210226548 TGGAAAGATTTTTCAGATAACGG + Intergenic
946988953 2:225306051-225306073 TGGTAGATATTTTCTCAAAAAGG + Intergenic
1174682971 20:52425715-52425737 TGGTCACTCTTTTCATATAAAGG + Intergenic
1177181070 21:17745390-17745412 TGGTCAGTTTTTACACAGAAAGG + Intergenic
1177455750 21:21335664-21335686 TGGTAAGTATTATAGCATAGTGG + Exonic
1178159028 21:29889251-29889273 TGTTAAGTATTTTTTCTTAAAGG + Intronic
1178406246 21:32325568-32325590 TGGTCATTATTGCCACATAAAGG - Intronic
1179529221 21:42007431-42007453 TGGTAAGTAGTGTCCAATAAGGG - Intronic
949714485 3:6913482-6913504 TGGTAAGTATTTTCACATAACGG - Intronic
950369524 3:12517044-12517066 TGGTTAGAATTTGCAGATAAGGG + Intronic
955717970 3:61850615-61850637 TGGACAGTATTTTCACATTGTGG + Intronic
955734684 3:62025713-62025735 TTGTAAATGTTTTCACATAAAGG + Intronic
956555514 3:70518181-70518203 AGTTAAGCATTTTAACATAACGG + Intergenic
956582618 3:70831180-70831202 TGGTAGGTTTTGTCACAGAAAGG - Intergenic
957103393 3:75855308-75855330 TGGTAATGATTTTCATTTAATGG + Intergenic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
957659738 3:83132707-83132729 TATTTAGTATTTTCATATAATGG - Intergenic
958734311 3:97990868-97990890 TGTTAAGTATATTCACATTGTGG - Intronic
958965136 3:100550534-100550556 TTTTAAGTTTTTTCTCATAATGG + Intronic
959128734 3:102324263-102324285 TGGTAAGAATTTGCAGAAAATGG + Intronic
959333483 3:105035668-105035690 TGGTAAGTATTTTCAAGTCCTGG + Intergenic
962014393 3:131425263-131425285 TAGTAGGTATGTTCACATCATGG - Intergenic
962219205 3:133549526-133549548 CGCTAAGTATTTACACATTAAGG - Intergenic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
962664856 3:137643582-137643604 TGGTAAGGATTTTAAAGTAATGG + Intergenic
963254228 3:143128895-143128917 TGCTCAGTATTTTTACATGAAGG + Intergenic
963334276 3:143954915-143954937 TGGAAAGTATTTTAAACTAAAGG + Intergenic
963497618 3:146086612-146086634 TTGTACGTATTTATACATAAAGG - Intronic
963634538 3:147777475-147777497 AACGAAGTATTTTCACATAATGG - Intergenic
964119514 3:153168088-153168110 TGGTATGCATTTTCCCAGAATGG - Intergenic
964225839 3:154400284-154400306 TTGTAAATAATTTCAAATAAGGG - Intronic
965471792 3:169102569-169102591 TGGTATGGATATTAACATAACGG + Intronic
966569288 3:181423103-181423125 TGGGAAGTATTTTCAACTAAAGG + Intergenic
967148785 3:186629167-186629189 TGGAAAGTATTCACACATATAGG - Intergenic
967991960 3:195138229-195138251 TGGTTATTATTTTCAAATGATGG - Intronic
968395943 4:238648-238670 TGGTAAATATTTTCTCCTATTGG + Intergenic
968435256 4:582730-582752 TGGTAATTATTTTCAAGAAATGG - Intergenic
969918397 4:10512529-10512551 TGGAAAATATTTTCACATCCTGG - Intronic
970025661 4:11621717-11621739 TTTTAAGTTGTTTCACATAATGG + Intergenic
970522915 4:16903532-16903554 GGGTAAGTATTTCCACTTAAAGG - Intergenic
970809294 4:20072746-20072768 TGCTAAGTACTTTCACAGTATGG + Intergenic
970838067 4:20434629-20434651 TGGAAAGTATTTTCAGTAAATGG + Intronic
971292293 4:25354993-25355015 TGGGAAGTATTTCCAAAGAAGGG - Intronic
971823839 4:31595639-31595661 TGGTATGAATGTTCACATAGTGG + Intergenic
973700977 4:53537047-53537069 AGGTGAGTCTTTTCACCTAATGG - Intronic
974072104 4:57133317-57133339 TTGTTTTTATTTTCACATAAGGG - Intergenic
974310017 4:60193260-60193282 AGGTAAGTATTTTCAAAACAAGG + Intergenic
974514759 4:62895687-62895709 TGGTAAATATTTTGACTTAAAGG + Intergenic
974547267 4:63328589-63328611 TGGAAAGCATTTTCACAAATAGG + Intergenic
974547294 4:63328931-63328953 TGGAAAGCATTTTCACAAATAGG + Intergenic
976746472 4:88407984-88408006 AGGTAAGGATTTTGAGATAAGGG + Intronic
976762423 4:88564199-88564221 TGTTGAGTATTTTTACATCAAGG + Intronic
977049547 4:92111578-92111600 TGGAAAGTATCTGCACAAAAGGG - Intergenic
978209245 4:106115297-106115319 TGGTAAGTATATACATATAATGG + Intronic
980402148 4:132304681-132304703 TGCTAAGCATTTTGACAGAAAGG - Intergenic
980727263 4:136779006-136779028 TTGTAAGTATTTTCACATCGAGG + Intergenic
980963452 4:139498809-139498831 TGGTCAGTTTTTACACAGAAAGG - Intronic
982307321 4:153946353-153946375 TAGTAGGTATTGTCACAAAATGG - Intergenic
982857369 4:160401094-160401116 TCAAATGTATTTTCACATAATGG - Intergenic
983352140 4:166603318-166603340 TGGTGAGTAGTTTCTCATGAGGG - Intergenic
984256485 4:177395396-177395418 TGGTTATTTTTTTCACTTAATGG - Intergenic
986938915 5:12925674-12925696 TGGAAAGTTTTCTTACATAAGGG - Intergenic
988351240 5:30110001-30110023 TAATCAATATTTTCACATAACGG + Intergenic
989182373 5:38591306-38591328 TGGTAATTATGTGCACATTAAGG + Intronic
989298249 5:39856386-39856408 TGGTAAGGATTTTGATATCAGGG - Intergenic
989762364 5:45032352-45032374 TGGGAAGTATTGTCAAATACAGG - Intergenic
990260125 5:54013222-54013244 TGGTAAGTTTTATCTCATATAGG + Intronic
992421323 5:76608258-76608280 TGTTAAGTATCTTGTCATAAAGG + Intronic
994196747 5:96930580-96930602 TGGAAAGTTATTTCTCATAAAGG - Intronic
996050782 5:118930604-118930626 TGGTAAGTAGTTTCTCTTGAGGG - Intronic
996078591 5:119228564-119228586 TGGGAAGCATTGTCAAATAACGG - Intronic
996583793 5:125062246-125062268 TGGGCAGAATTTTCAAATAAAGG - Intergenic
997164573 5:131646053-131646075 TCTTAAATATTTTTACATAAAGG + Intronic
998806467 5:145921891-145921913 TGCTATTTATTTTCACTTAAAGG + Intergenic
1003057140 6:2832153-2832175 TGGTAAGTATTTTAAGAAAGCGG + Intergenic
1008748007 6:54696847-54696869 TGCTAAGTTTTTTCACATAAGGG + Intergenic
1009773105 6:68169895-68169917 TGGATAGTATTTTCACTTATTGG - Intergenic
1009851177 6:69201174-69201196 AGGGAAGTATTTTAAGATAAAGG - Intronic
1010258376 6:73786928-73786950 TGGTAAGGATGTGCACAGAAAGG - Intronic
1012409533 6:98940872-98940894 TGGGAAGTATTTGCTCTTAAGGG + Intronic
1014137396 6:117906255-117906277 AGGTAAGTTTGTTCACACAAAGG - Intergenic
1014445929 6:121527411-121527433 AAGTAAATATTTTCACTTAAAGG + Intergenic
1014585818 6:123196469-123196491 TTATAAGTATATTCACTTAATGG - Intergenic
1015163241 6:130176110-130176132 TTGAAATTATTTTCACATCATGG + Intronic
1015327330 6:131937828-131937850 TGGTGAGTGTTTTCTCATCAAGG + Intergenic
1015706847 6:136097406-136097428 TGGTAAGAAATTTCATATGAGGG - Intronic
1015943100 6:138471542-138471564 TGAAAGGTATTTTCACATATTGG - Intronic
1016397105 6:143636309-143636331 TGAAATGTATTTTTACATAAGGG + Intronic
1016589152 6:145724747-145724769 TGGACAGTATTTTCAAAAAATGG + Intronic
1018591380 6:165427249-165427271 TGGTACGTATATCCACAAAATGG + Intronic
1018692247 6:166356295-166356317 TGCTATGTATTTTCTCATTATGG - Intergenic
1018863123 6:167726489-167726511 TTGTTAGTATTTTCAGATGAGGG - Intergenic
1019120292 6:169797929-169797951 TGATAAGTATTTTCATAACATGG - Intergenic
1019182780 6:170201839-170201861 TCTTAAGCATTTTTACATAAGGG - Intergenic
1019955904 7:4414281-4414303 TGGTAAAGATTTTCATATACAGG + Intergenic
1020268216 7:6576054-6576076 TGGTAAGGAGTTTCATAAAAAGG + Intergenic
1020701916 7:11495227-11495249 TGTTACGTATTTTTAAATAAAGG - Intronic
1022227718 7:28380878-28380900 TGCTGGGTATTTTCACATATAGG - Intronic
1022238415 7:28485548-28485570 TGGTAGATATTTTCAAATTATGG - Intronic
1023331740 7:39125056-39125078 TGGTAGGTATTTTTATATCAAGG - Intronic
1023723142 7:43115264-43115286 TGGTGAGTAATTTCACTTATGGG - Intronic
1024630623 7:51244027-51244049 GGGAAAGCATTTTCACATGATGG - Intronic
1024756141 7:52534277-52534299 TGGTAAACATTTTCACTTGATGG - Intergenic
1027943846 7:84721025-84721047 TGGATAGTCTTTTAACATAATGG + Intergenic
1028888549 7:95961336-95961358 TGGTTAGTTTTTTCACTGAATGG - Intronic
1034509389 7:151521161-151521183 TTTTAAGTATTTTAAAATAAAGG + Intergenic
1034783661 7:153905177-153905199 TGGTCAGTTTTTACACAGAAAGG + Intronic
1036011140 8:4725999-4726021 TTGTAAGAATTTTCTCATAATGG + Intronic
1037568071 8:20134539-20134561 TGGTAAGTATTGACAGAGAAGGG + Intergenic
1038673846 8:29605348-29605370 TAGAAAATATTTTCACTTAATGG - Intergenic
1038822162 8:30962545-30962567 TGTAAATTAATTTCACATAATGG - Intergenic
1038905714 8:31900195-31900217 ACTTAAGTATTTTCACATACTGG - Intronic
1039771800 8:40694865-40694887 TGGTCAGTTTTTACACAGAAAGG - Intronic
1041372742 8:57180363-57180385 TTGTCAGCATTTTCACATAAGGG + Intergenic
1041704013 8:60826102-60826124 TCTTAAGCTTTTTCACATAATGG + Intronic
1042081007 8:65050780-65050802 TGGCAAATAGTTTCACATACAGG - Intergenic
1042321399 8:67479074-67479096 TGCTAATTATTTTCAATTAATGG + Intronic
1044511378 8:93083873-93083895 CTGCAAGTATTTTTACATAAAGG + Intergenic
1045662155 8:104449249-104449271 TTGTTAGCATATTCACATAATGG + Intronic
1048076462 8:131076741-131076763 TGATAGGTTTTTTCACAGAATGG + Intergenic
1048669826 8:136705582-136705604 TTGAAAGAGTTTTCACATAATGG - Intergenic
1050016021 9:1235537-1235559 TGGTAACTGTTATCAAATAAAGG + Intergenic
1051056428 9:12992620-12992642 TGATACTTATTTTCAAATAATGG - Intergenic
1052774268 9:32718316-32718338 TGGTTAGTAGTTGCACATATAGG - Intergenic
1052780978 9:32782468-32782490 TGGAAAGAATTTTCACATCCAGG - Intergenic
1054920346 9:70536997-70537019 TGGAAAGTATTTTTAAAGAAAGG - Exonic
1055596647 9:77872263-77872285 TGTTAGGAATTTTCACATAATGG - Intronic
1058345855 9:103961151-103961173 TTGTAAGTATTATCTCATTAGGG + Intergenic
1058858618 9:109091695-109091717 GGGTGAGGATTTTCAAATAAAGG + Intronic
1058882908 9:109300856-109300878 TGGTAACTGATTTCACATATAGG - Intronic
1059578700 9:115520092-115520114 TTGTGTGTATTTTCAGATAACGG + Intergenic
1060439924 9:123628708-123628730 TGGAAACTATTTTCAGTTAATGG - Intronic
1203679427 Un_KI270756v1:51030-51052 TGGAAATTATTTGCACAGAATGG - Intergenic
1186541081 X:10400935-10400957 TAGTAAGTAGTTTCACATACTGG + Intergenic
1188206605 X:27367054-27367076 TAGTGAGTTTTTTCATATAATGG + Intergenic
1188301540 X:28510414-28510436 TTGAAACTATTTTCACATGATGG - Intergenic
1189582602 X:42423108-42423130 TGGTAAGTATGATAACATCAAGG + Intergenic
1190258352 X:48781860-48781882 TAGTAGGTATTTTCATACAAAGG + Intergenic
1190894348 X:54601943-54601965 TGGTATGTATATCCATATAATGG - Intergenic
1190924016 X:54885234-54885256 TGGTATGTATATCCATATAATGG + Intergenic
1194124085 X:89992312-89992334 TGGTGAATATTTTCCCATTACGG - Intergenic
1195526977 X:105902449-105902471 TGATAATTATTATCTCATAAGGG + Intronic
1196321183 X:114341944-114341966 GAGTAAATATTTTCAAATAAGGG + Intergenic
1197190853 X:123646629-123646651 GTGTATGTATTTTCCCATAAAGG - Intronic
1197302259 X:124795429-124795451 AGGTAACTATTTTTAGATAATGG - Intronic
1199073120 X:143501610-143501632 TGGTCAGTTTTTACACAGAAAGG + Intergenic
1200476972 Y:3649934-3649956 TGGTGAATATTTTCCCATTACGG - Intergenic