ID: 949716381

View in Genome Browser
Species Human (GRCh38)
Location 3:6936259-6936281
Sequence CTATTACAGAACCTCTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949716381_949716385 20 Left 949716381 3:6936259-6936281 CCCATCAAGAGGTTCTGTAATAG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 949716385 3:6936302-6936324 TCCCCATAAACAGCTTTTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949716381 Original CRISPR CTATTACAGAACCTCTTGAT GGG (reversed) Intronic
900893334 1:5465447-5465469 CTAGTACAGAACCTCTCTAATGG - Intergenic
901328006 1:8380645-8380667 CTTTTAAAAAAGCTCTTGATGGG - Intronic
906358478 1:45130251-45130273 CTATTAAAGAACCTATTAATAGG + Intronic
908119338 1:60971086-60971108 CCATGACAGAACCTCCTGCTTGG + Intronic
910954375 1:92685871-92685893 CAATTTCAGAACCTGTTAATTGG - Intronic
918231407 1:182536486-182536508 CTATTACATACCCTCTAGAATGG - Intronic
918969905 1:191400447-191400469 CTATCAAAGAACATCTTGATTGG - Intergenic
919538741 1:198822065-198822087 TTATTACAGAATGTCTTGATAGG + Intergenic
919766784 1:201132481-201132503 CTATTACAGAACAGCATGGTTGG + Intergenic
921515359 1:216084786-216084808 CTATTTGGGAACCTCTGGATTGG - Exonic
1063370451 10:5518559-5518581 CTATTACAACACCACTTCATGGG + Intergenic
1067817136 10:49488730-49488752 CTTTTAAAGAACATGTTGATGGG + Intronic
1078320171 11:10327326-10327348 CTATTACAGGACCCAGTGATGGG + Intronic
1081671495 11:44945162-44945184 CTATCACAGAAGCTCTTGTTTGG - Intronic
1086000574 11:81979459-81979481 CTATTAAAGAATCACATGATGGG - Intergenic
1086315800 11:85590572-85590594 CTATTTCAGGACATCTTGAAAGG + Intronic
1088713468 11:112528419-112528441 CTATTTCAGATCCTTTTAATAGG - Intergenic
1088834095 11:113562571-113562593 CTACTTCAGAACCTCTTACTTGG - Intergenic
1089512945 11:119012010-119012032 CTATTAGGGAATCTCTTGTTGGG + Intronic
1089940961 11:122417071-122417093 GTATTACAGAACCTTTGGCTTGG + Intergenic
1090161737 11:124502345-124502367 TTATTACAGAAACTCTTCCTAGG - Intergenic
1091432704 12:450449-450471 CTCTTCCAGAGCCTCTTAATTGG + Intergenic
1099245006 12:80183961-80183983 CTTTTATAGAAACTCTTTATGGG + Intergenic
1099500495 12:83407951-83407973 CCTTTACAGAACCTTTTGAGAGG - Intergenic
1101726089 12:107389499-107389521 CAGTTTCAGAACCTCTTGTTGGG - Intronic
1105428469 13:20315836-20315858 ATATTACAAAACCTCCTTATTGG - Intergenic
1120357168 14:83449527-83449549 ATATAACATAACCTCTTCATGGG - Intergenic
1122108446 14:99479244-99479266 CAGCTACAGAACCTCTTTATTGG - Intronic
1126289640 15:47059039-47059061 GTATTACAGAATCCCTTGCTGGG - Intergenic
1137263244 16:46847908-46847930 TTATTAAAGAACCTCCTGCTAGG - Intergenic
1139159602 16:64488503-64488525 CTATTACAGAACCCTTTTATTGG - Intergenic
1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG + Intergenic
1143799535 17:9367243-9367265 CTGTTACATGACCTCTTGGTAGG + Intronic
1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG + Intergenic
1163232052 19:16010791-16010813 CTATCTCAGAACTTCTTGAAGGG - Intergenic
1165296383 19:34929518-34929540 CCATTAAAGAAGCTCTGGATTGG + Intronic
930381082 2:50630232-50630254 CCATTACTGAACCACTTCATTGG + Intronic
931292541 2:60887721-60887743 CTACTGCAGAAGCTCTTAATTGG - Intronic
940470853 2:154098317-154098339 CTATTATAAAACCTTTTGAATGG + Intronic
941354628 2:164474520-164474542 TTATTAGAAAACCTCTTGAGAGG + Intergenic
943021847 2:182583950-182583972 ATATTATTGAATCTCTTGATAGG - Intergenic
944928895 2:204495714-204495736 TTAATTCAGAACATCTTGATTGG + Intergenic
945142714 2:206703927-206703949 CTTTTGCAGAACTTCTTGCTTGG + Intronic
948704841 2:239783144-239783166 CTATTACAGAACATGTGGACTGG + Intronic
1174232249 20:49055365-49055387 CTATTACAGAAGCTCCTTCTAGG + Intronic
949716381 3:6936259-6936281 CTATTACAGAACCTCTTGATGGG - Intronic
950879482 3:16311512-16311534 CTTTTCCAGAACCTCTTGCATGG - Intronic
960473391 3:118094794-118094816 CTATTACAGAGTATCTAGATGGG - Intergenic
960724270 3:120654435-120654457 GAATCACAGAACCTCTGGATTGG - Intronic
961405239 3:126673644-126673666 CCATCACAGAACCACTGGATGGG + Intergenic
963122527 3:141788354-141788376 TTATTACAGTAGCTCTTGGTGGG - Intronic
963932196 3:151014943-151014965 CTATTATATATCCCCTTGATGGG - Intergenic
964723401 3:159790248-159790270 CTTTTACAGAAACTTTTTATTGG + Intronic
969420880 4:7095109-7095131 CTTTTACAGAATCTCTTTCTTGG + Intergenic
970746898 4:19309495-19309517 CTATTACAGAACATAATGACAGG - Intergenic
972683024 4:41325166-41325188 CTATTATAGAACCTAAGGATTGG - Intergenic
976780080 4:88748989-88749011 CCATTTCAGAACCTCCGGATTGG + Exonic
977427727 4:96890333-96890355 CTATAACAGGAGCTCTTTATGGG + Intergenic
984754028 4:183308338-183308360 CTATTACATAATAACTTGATGGG - Intronic
988437078 5:31189281-31189303 CAATTATAGAAGCACTTGATGGG - Intergenic
994439693 5:99786769-99786791 CTACTAAAGAACATCTTGGTTGG + Intergenic
994565260 5:101437796-101437818 CTATTGCAGGTCCTCTTGTTGGG + Intergenic
995415127 5:111902346-111902368 CTATTACAGCACATGTTGAGTGG - Intronic
996995837 5:129695858-129695880 CCATTACAGAAGCTCTTGTGAGG - Intronic
998382286 5:141734476-141734498 CTATCCCAGGCCCTCTTGATGGG + Intergenic
1000058961 5:157635881-157635903 TTATGACAGCTCCTCTTGATTGG - Intronic
1007260631 6:40560476-40560498 CTACTACAGAGCCTCCTGAATGG - Intronic
1014530872 6:122557722-122557744 CTCTAACAGAATCACTTGATGGG + Intronic
1015516879 6:134091349-134091371 CTTTTACAGAACTTCTTTAGAGG + Intergenic
1027521966 7:79220554-79220576 CCTTTAAAGAACCTCTTGGTTGG + Intronic
1032859121 7:135861091-135861113 CTAATACAGGCCCTCATGATGGG - Intergenic
1041597678 8:59676107-59676129 CTTTTACCGAAACACTTGATGGG + Intergenic
1048297878 8:133228147-133228169 CCATTACAGTACCTCTTGGCAGG - Exonic
1052766455 9:32646175-32646197 CACTTACAGCACCTCTTAATTGG + Intergenic
1056306401 9:85294937-85294959 CTCTTCCAGAACCTCATGCTGGG + Intergenic
1059869331 9:118554151-118554173 CAATTACAGAATCTTTTCATGGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1197407097 X:126066000-126066022 GTGTTACAGAAGCTCTTGTTTGG - Intergenic
1198004224 X:132475645-132475667 CTATTACAGGACGTTTTTATTGG + Intronic
1198514623 X:137393158-137393180 CTACTACACAACCTCTAGAATGG + Intergenic
1199201025 X:145088861-145088883 CTAATACAGAACCTTTAGTTGGG + Intergenic