ID: 949716799

View in Genome Browser
Species Human (GRCh38)
Location 3:6941404-6941426
Sequence ATTCAAAACAATCAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949716799 Original CRISPR ATTCAAAACAATCAGCAGGA AGG Intronic
902197306 1:14807176-14807198 TTTCAGGACAACCAGCAGGAGGG + Intronic
902567807 1:17324778-17324800 ATACACAAAAATCAGCTGGAGGG - Intronic
903408317 1:23117793-23117815 ATTAAAAACAAACAGGAGGCTGG + Intronic
903641630 1:24863970-24863992 ATACAAAACAATTAGCTGGGCGG - Intergenic
905663424 1:39746359-39746381 ATGCAAAACCCCCAGCAGGATGG - Intronic
909741316 1:79032777-79032799 ATTCAAAATAATAAGAAAGATGG + Intergenic
911844562 1:102734650-102734672 CTCCAAAATAATCAGGAGGAAGG - Intergenic
914232610 1:145777830-145777852 ATTCAAAATAAAAAACAGGATGG + Intronic
916007313 1:160674354-160674376 AAAAAAAATAATCAGCAGGATGG + Intergenic
916083628 1:161252533-161252555 ATACAAAAAAATTAGCTGGATGG + Intergenic
916087294 1:161280797-161280819 ATTAAGAAAAATCAACAGGATGG - Intronic
916239794 1:162627766-162627788 ATTGAGTACAATTAGCAGGAGGG - Intergenic
916258527 1:162816191-162816213 ATCCAAAGCAAGCAGAAGGAAGG - Intergenic
916781185 1:168031538-168031560 ATTCAAAACAATAAGCTAGGAGG + Intronic
917724867 1:177818700-177818722 ATACATCAGAATCAGCAGGAGGG - Intergenic
918854119 1:189729020-189729042 ATTCAAAAGACTGAGAAGGAGGG - Intergenic
920612838 1:207458470-207458492 AGTCAGAAAACTCAGCAGGAGGG - Intronic
920707306 1:208263095-208263117 CTTCAAAACAATCAGAAGTGTGG + Intergenic
921377890 1:214492930-214492952 ATTCACAACACATAGCAGGAGGG + Intronic
921773941 1:219075167-219075189 AATCAAATCAATCATCAGGATGG - Intergenic
922111148 1:222557093-222557115 ATTCTAAACCATCTGCAAGAAGG - Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
923253973 1:232203345-232203367 ACTCAAAGCAAACAGAAGGAAGG + Intergenic
924167923 1:241304562-241304584 AAGCAAATCACTCAGCAGGAGGG + Intronic
924232161 1:241971263-241971285 ATTGAAAAGAAGCAGCAGGCCGG - Intergenic
924357459 1:243197118-243197140 ATACAAAATAAACTGCAGGAGGG + Intronic
1065703248 10:28445700-28445722 ATTCAAAACATTCTGCAGTTTGG + Intergenic
1066455993 10:35572678-35572700 ACTCAAAAAACACAGCAGGAAGG - Intergenic
1068050894 10:51947610-51947632 ATTTAAAACAAACAGCAGGAGGG - Intronic
1069079857 10:64077279-64077301 ATGCAAAACAGGCAGCTGGATGG + Intergenic
1072033300 10:91541537-91541559 ACTGAAAATAATCAACAGGAAGG + Intergenic
1073980828 10:109151747-109151769 ATTCAAAATAAAAAGCAAGAAGG - Intergenic
1074005295 10:109416025-109416047 ATATAAAACAATTAGCAAGATGG + Intergenic
1074418031 10:113284447-113284469 TGTCAAAACAACCAGCAAGACGG + Intergenic
1076030443 10:127153209-127153231 AGTCAAAACCTTCAGAAGGATGG - Intronic
1077363806 11:2153273-2153295 AATCAAAAAAACAAGCAGGAGGG - Intronic
1077913072 11:6590951-6590973 ATCCAAAGCAAGCAGAAGGAAGG - Intronic
1078034356 11:7787242-7787264 ATTAAAAACAAAAAGAAGGAAGG + Intergenic
1078219426 11:9339241-9339263 ATTAAAAACAAACAGCAGCCGGG + Intergenic
1079678024 11:23256771-23256793 TTTCAAAACATTAAGGAGGAGGG - Intergenic
1080013188 11:27478589-27478611 TTCCAAAACAATCAGTAGGCTGG - Intergenic
1080358581 11:31484362-31484384 ATTCAAAACAATGTACAGTAAGG - Intronic
1081846019 11:46241002-46241024 CTTCAAAACCATAAGCAGGCCGG - Intergenic
1082007837 11:47429927-47429949 AATCAAAACAATCAAGCGGAGGG + Intergenic
1083206857 11:61156181-61156203 ATTGAAAACAAATAGCAAGAAGG + Intronic
1084140677 11:67226356-67226378 AAACAAAACTAACAGCAGGATGG - Intronic
1085849455 11:80103004-80103026 ATACAAAAAAATCAGCTGGGTGG - Intergenic
1088669329 11:112126413-112126435 ATTTAAAACAATGAGTACGAAGG - Intronic
1089876956 11:121732441-121732463 ACCCAAAACAAACAGAAGGAAGG - Intergenic
1089895271 11:121924326-121924348 AGTCAAAACAAGCGTCAGGAGGG - Intergenic
1090871293 11:130751432-130751454 ATTTAAAACAAACAGCAAAATGG + Intergenic
1091033226 11:132210294-132210316 AGTCAAAACCAGCATCAGGAGGG + Intronic
1091414712 12:271332-271354 AACCAAAAGAAGCAGCAGGAGGG - Intergenic
1092607652 12:10137629-10137651 ATTCAAAAGATTCAGGAGAAGGG + Intergenic
1092611112 12:10174216-10174238 ATACAAAACAATTAGCCGGGAGG - Intronic
1093464672 12:19437636-19437658 ATTAAAAACTATCAGAAGGCCGG - Intronic
1093815495 12:23540870-23540892 ATCCAAAACAATCAGCAAAGAGG + Intronic
1093881733 12:24412309-24412331 ATCCAAAGCAAGCAGAAGGAAGG - Intergenic
1094278047 12:28701233-28701255 ATTGAAAATAATAAGCAAGAGGG - Intergenic
1094812511 12:34152554-34152576 TTTCAGAACAAGCAGCAAGAAGG + Intergenic
1095912050 12:47437735-47437757 ATCCAAAGCAAACAGAAGGAAGG + Intergenic
1096761838 12:53848497-53848519 GATCAAAATAATCAGGAGGAAGG + Intergenic
1097337755 12:58403364-58403386 AGTCAAGATAATAAGCAGGATGG - Intergenic
1098975553 12:76898395-76898417 ATAGAAAACAAACAGCAAGAAGG + Intergenic
1099662074 12:85576848-85576870 ATACAAAAAAATTAGCTGGATGG + Intergenic
1099930945 12:89073866-89073888 TTACAAAACAAACAGCAGGCAGG + Intergenic
1101034048 12:100687333-100687355 ATACAGGACAACCAGCAGGAAGG - Intergenic
1102527706 12:113523840-113523862 ATCAAAAACAATCAGGAAGATGG - Intergenic
1103551725 12:121742869-121742891 ATTAAAAACAATAAGCTGGCCGG - Intronic
1103578318 12:121895298-121895320 ATTAAAAACAATCAGCACCTTGG - Intronic
1105565983 13:21548759-21548781 GATCAAAACAATCACCCGGAGGG + Intronic
1106887936 13:34210232-34210254 ATCCAGAGCAAGCAGCAGGAGGG + Intergenic
1106939941 13:34767377-34767399 ATTCAAAACAATAGGCCGGGAGG - Intergenic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107276099 13:38681011-38681033 ATTCAAAAGTCTAAGCAGGATGG - Intergenic
1107381973 13:39866415-39866437 AATTAAAGCAATCAGAAGGAGGG + Intergenic
1108854713 13:54778430-54778452 TTTCAAAACATTCAGGTGGAGGG + Intergenic
1109154260 13:58885536-58885558 TTTTAAAACAATCACCATGATGG - Intergenic
1110595361 13:77315596-77315618 ATTAAAAACTATCAGCAAGCCGG + Intronic
1111279743 13:86005730-86005752 ATTCAAAAAAATTAGCGGGGTGG + Intergenic
1111312269 13:86504019-86504041 ATTCAAAACTATCAATAGCATGG + Intergenic
1111947744 13:94683215-94683237 ATTCACAAAAATGAGAAGGATGG + Intergenic
1112598132 13:100828694-100828716 AATCAAAACAACCAGCAGCCTGG - Intergenic
1112971018 13:105262637-105262659 ATTCACAAGAAACTGCAGGATGG + Intergenic
1113086592 13:106575136-106575158 ATTCAACACTGTCAGCAGTAAGG + Intergenic
1113219891 13:108087850-108087872 ATTTAAAGCATTCAGCAGAAGGG - Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114310904 14:21466186-21466208 ACTAAAAATAATTAGCAGGATGG + Intronic
1114511519 14:23265787-23265809 ATCCAAAATAATGAGAAGGAAGG - Intronic
1116052310 14:39819983-39820005 ATCCAAAGCAAGCAGAAGGAAGG - Intergenic
1118099982 14:62587092-62587114 ATTCAAAGCAAGCAGCAGGAAGG - Intergenic
1118268047 14:64314471-64314493 ATCCAAAGCAAGCAGAAGGAAGG + Intronic
1119336843 14:73840506-73840528 ATTCAAAACAGTCATCAGTATGG + Intergenic
1119724232 14:76912491-76912513 ACCCAAAAGAATCAGCAGGAAGG + Intergenic
1120422836 14:84310080-84310102 TTTAAAAGCTATCAGCAGGAAGG - Intergenic
1120504969 14:85344285-85344307 ATTCTAAACGATCAGCCCGAAGG + Intergenic
1120994007 14:90401570-90401592 ATTCTAGACACTAAGCAGGATGG - Intronic
1122265693 14:100545779-100545801 ATTCAAAACACTCAGGAGCTGGG + Intronic
1122511940 14:102276086-102276108 ATTCCACACAATCATCAGAATGG + Intronic
1122527974 14:102402509-102402531 ACTCAAAACTAGCAGAAGGAAGG + Intronic
1124182153 15:27486325-27486347 AGTCAAAACAATCAGGAGAAAGG + Intronic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125309970 15:38368058-38368080 AGACAAAACAAAAAGCAGGAAGG + Intergenic
1125359193 15:38848028-38848050 ATTTAAAAGAATCACCAGGCTGG + Intergenic
1127117258 15:55741664-55741686 ATCCACAACGATCAGGAGGAAGG - Intronic
1127190056 15:56519931-56519953 ATACAAAACAATCATCACCAAGG + Intergenic
1127558464 15:60111575-60111597 ATTCAAAGAAAGCAACAGGAAGG + Intergenic
1127648879 15:60986900-60986922 ATTCAACACAATCCGCAGACCGG + Intronic
1128928133 15:71677663-71677685 ATGTGAAACAATCAGCAGAAGGG - Intronic
1129347906 15:74935929-74935951 AATCTAAACAAACATCAGGATGG + Intronic
1129568934 15:76657500-76657522 ATTCCAAATAATGAGGAGGAGGG + Intronic
1133004921 16:2874677-2874699 ATCCAAAAAAATCAGCGGGACGG + Intergenic
1134201686 16:12204614-12204636 CATCAAAATAATCAGCAGCAAGG + Intronic
1136645025 16:31606460-31606482 ATTCCAAAAAATAAGGAGGAGGG + Intergenic
1137356182 16:47767323-47767345 ATCCAAAACAAGCAGAAGTAAGG + Intergenic
1137964493 16:52916999-52917021 ATTCAAAACTCTCCGCAGGAAGG + Intergenic
1138356131 16:56382027-56382049 ATTCAAAAGAATTAGAAGCAGGG + Intronic
1138371452 16:56530330-56530352 ATACAAAACAATTAGCTGGGTGG + Intergenic
1138397760 16:56719090-56719112 ATGGAAAACAATCTGCAGAATGG + Intronic
1138508386 16:57491746-57491768 ATTCAAAACCAGCAGAAGTAAGG - Intergenic
1138682078 16:58691969-58691991 ATAGAAAACAAACAGCACGATGG - Intergenic
1138872818 16:60912290-60912312 CAACAAAACAAACAGCAGGATGG - Intergenic
1138980394 16:62260645-62260667 ATTAAAAACAAGCATCAGGGTGG + Intergenic
1140159848 16:72478087-72478109 ACCCAAAACAAGCAGAAGGAAGG + Intergenic
1142916590 17:3144867-3144889 ATTCAAAGCAAACACAAGGAAGG - Intergenic
1143841520 17:9735796-9735818 ATTCAAAAGCTTCAGCAGGCAGG - Intergenic
1144039584 17:11397979-11398001 ATTAAAAACAACCAGCAGAAAGG - Intronic
1144488926 17:15691258-15691280 GTTCATAGTAATCAGCAGGAAGG - Intergenic
1144599348 17:16598980-16599002 ATACAAAAAAATTAGCCGGATGG - Intergenic
1144912094 17:18691045-18691067 GTTCATAGTAATCAGCAGGAAGG + Intergenic
1146803570 17:35846937-35846959 ATTCAAAACAGTCATCAGTATGG - Exonic
1148067138 17:44879937-44879959 ATTCAAGACAATCTGGAGGCAGG + Intronic
1149030034 17:52072266-52072288 ATTAAAAACAATTAGAATGAAGG - Intronic
1149326966 17:55541642-55541664 ATACAAAACAAACAGCAAGATGG - Intergenic
1149680944 17:58506869-58506891 AATCTAAACACACAGCAGGAAGG + Exonic
1150662065 17:67090900-67090922 ATTCAAATCAAGCAGAGGGAAGG - Intronic
1152447870 17:80356296-80356318 ATTCAAAAGCATCAACAGGCCGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153501975 18:5759144-5759166 GTTCAAAACAATGGGAAGGATGG - Intergenic
1156857064 18:41794113-41794135 ATTAAAGACAATCATCAGCAAGG + Intergenic
1157085841 18:44580172-44580194 ATTTCAACCAATCACCAGGAAGG + Intergenic
1157766950 18:50306133-50306155 ATACAAAACAAGCAGAAGAAAGG - Intergenic
1157928508 18:51792564-51792586 ATTTATAAAAATCAGTAGGAGGG + Intergenic
1158207703 18:55011956-55011978 TTTTAAAACAATAAGCAGCAGGG - Intergenic
1159467418 18:68802827-68802849 TTTCAAAAGAATCAGCAGATGGG - Intronic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1160054921 18:75470077-75470099 ATTTCATACAATCAGTAGGATGG - Intergenic
1162112835 19:8409896-8409918 ATACAAAAAAATCAGCCGGGTGG + Intronic
1163137068 19:15319634-15319656 ATTCAAAACCATCAAGAGGCAGG + Intronic
1166100948 19:40570995-40571017 ATTCCAACCAATGAACAGGAAGG + Intronic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
927645051 2:24872304-24872326 AAACAAAACAAAGAGCAGGAAGG + Intronic
928368566 2:30722248-30722270 ATTCAAAAGCATTAGCAAGAGGG + Intergenic
930349003 2:50225227-50225249 ATGGAAAACTACCAGCAGGAGGG + Intronic
930400662 2:50880816-50880838 ATTCACAACAAACATCAGTATGG + Intronic
931974285 2:67626054-67626076 ATTCAGAACAGACATCAGGAAGG - Intergenic
932004806 2:67917482-67917504 ATTCAAAAAAATCAGAACAATGG + Intergenic
932016522 2:68033415-68033437 ATTTAAAACAATTAGTAAGAAGG + Intergenic
932296522 2:70628097-70628119 ATTGAAAACAACTAGCAAGATGG + Intronic
932511955 2:72301383-72301405 ATTCAAAAAACTGAGAAGGAGGG - Intronic
933872378 2:86580018-86580040 ACCCAAAACAAGCAGAAGGAAGG + Intronic
933884811 2:86708686-86708708 ACTCAAAGCAAGCAGAAGGAAGG - Intronic
934723499 2:96598989-96599011 ATTCAAAACTATCATGAGAAAGG + Intronic
934931024 2:98423510-98423532 ACCCAAAACAAGCAGAAGGAAGG + Intergenic
935405407 2:102703991-102704013 ATTCAAAACAGACTGTAGGATGG + Intronic
935540765 2:104345527-104345549 ACCCAAAACAAACAGAAGGAAGG + Intergenic
935858799 2:107304734-107304756 AATGAAAACAACCAGCAGGAAGG + Intergenic
937118057 2:119423194-119423216 ATTGAAAACATGCAGCAGGAAGG - Intergenic
938325598 2:130397387-130397409 TTTCAAAACAATGAAAAGGAGGG + Intergenic
938423358 2:131162814-131162836 TTTCAAAACAATGAAAAGGAGGG - Intronic
939259622 2:139790359-139790381 ATTGAAAGAAATCAGCATGAAGG + Intergenic
939608529 2:144281977-144281999 ATTCAAAAGAATCACCCGGAAGG + Intronic
939624098 2:144455352-144455374 ATTCAAAACAGTGTGCAGGTTGG - Intronic
939785193 2:146500972-146500994 ATTCAAAATTATCAGATGGATGG + Intergenic
940020426 2:149150894-149150916 ATTTAAAAAAATCAGTAGAAGGG - Intronic
940630085 2:156227530-156227552 ATCAAAAACAAGCAGAAGGAAGG + Intergenic
940699003 2:157018220-157018242 ATGGAAAACAAACAGCAAGATGG - Intergenic
940827698 2:158432233-158432255 AATAAAAAAAAACAGCAGGATGG + Intronic
941163364 2:162059783-162059805 AGGCAAAACATTCAGCAGTATGG + Intronic
943945535 2:194057518-194057540 ACCCAACACAATCAGAAGGAAGG + Intergenic
945262532 2:207857850-207857872 ATCCAAAGCAAGCAGAAGGAAGG - Intronic
945883739 2:215353254-215353276 ATTCAAAACAATGTCAAGGAAGG - Intergenic
945972796 2:216246510-216246532 ATTAAAAACAATGAGTAGGCCGG - Intergenic
946208169 2:218125880-218125902 ATTCAACAGAAACAGAAGGAGGG + Intronic
946209221 2:218133946-218133968 ATTAAAAACAATAAGCAAGCGGG - Intronic
946854217 2:223936761-223936783 ATTCCAAACTCTCAGAAGGAAGG - Intronic
947026363 2:225742346-225742368 ATTAAATACAATCAGCTGGGAGG + Intergenic
947184576 2:227443874-227443896 ATTCAAAGAAATCATAAGGAAGG + Intergenic
948517818 2:238516142-238516164 ACTGAAAACAAGCAGAAGGAAGG - Intergenic
1169546610 20:6656823-6656845 ATTTAAAACTATCCTCAGGAAGG - Intergenic
1169888415 20:10428006-10428028 ATTCACAGCAATGAGCAGGGAGG - Intronic
1170374140 20:15681410-15681432 ATTCAAAGACTTCAGCAGGATGG - Intronic
1170915715 20:20623057-20623079 ATTAAAAACAATGAGCTTGAAGG + Intronic
1171752736 20:29069413-29069435 ATTCAAAAAAATGAAAAGGAGGG + Intergenic
1172224848 20:33298537-33298559 ATACAAAACACCCAGCGGGAGGG - Intronic
1172501104 20:35428175-35428197 ATTAAAAAAAATTAGCTGGATGG - Intergenic
1172767279 20:37357509-37357531 ATTCAAAACAATGAACAGCTGGG - Intronic
1172854881 20:37994060-37994082 ATTAAGAACAAACAACAGGATGG + Intronic
1174520814 20:51129177-51129199 CTTTAAAATAATCGGCAGGAAGG + Intergenic
1174645637 20:52083114-52083136 ATTCACGACAAACAGCAGAAAGG + Intronic
1177556347 21:22694010-22694032 ATTCAAAACAATTAGAAAGGAGG - Intergenic
1179303669 21:40135626-40135648 AAGAAAAACAATGAGCAGGAAGG - Intronic
1181583431 22:23840218-23840240 ATTCAAAAGAATCAAAAGCAGGG + Intergenic
1181930953 22:26401281-26401303 ATGAAGGACAATCAGCAGGAGGG + Intergenic
1183919079 22:41149538-41149560 CTTCAAACCATTCAGCAGAATGG - Intronic
1184308042 22:43621659-43621681 ATCCAAAACAAGCAGAAAGAAGG + Intronic
1184882106 22:47314100-47314122 ATACAAAACAAATAGCAGGGTGG - Intergenic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
950298207 3:11850265-11850287 ATGCAAAACCACCAGCTGGAAGG + Intergenic
950568080 3:13783213-13783235 ATTCAACAGAAACAGCAGGCTGG - Intergenic
950622855 3:14220193-14220215 AATCAAAGCAAGCAGAAGGAGGG - Intergenic
950940627 3:16886926-16886948 ATTCAAAACAATTAAAAGAAAGG - Intronic
952444624 3:33368982-33369004 ATAGAAAACAAACAGCAAGAGGG - Intronic
953544177 3:43850660-43850682 ATAGAAAACCAACAGCAGGATGG - Intergenic
953965859 3:47306079-47306101 ACTCAAAGCAAGCAGAAGGAAGG - Intronic
955127303 3:56126077-56126099 ATTTAAAATAATCAGGGGGATGG - Intronic
955437816 3:58922227-58922249 ATTGAAAACAAAGAGCAAGATGG - Intronic
960348289 3:116562050-116562072 ATTAAAAACAAATAGCAGAATGG + Intronic
960988383 3:123295115-123295137 ATGCAAAATACTCAGCAGAAGGG + Intronic
961663887 3:128484693-128484715 ATGCAAAACAAACAGGAGAAAGG + Intronic
962240896 3:133750032-133750054 TTGCAACACAATCATCAGGATGG - Intronic
962287961 3:134104334-134104356 AAACAAAACAATCAGCAGAGTGG - Intronic
964678521 3:159311178-159311200 ATTTAAAACAAACAGCAAAAAGG - Intronic
964825735 3:160825965-160825987 ATTCAAAAGTCTGAGCAGGAAGG - Intronic
965630820 3:170730786-170730808 ATACAAAACAATTAGCCGGGTGG + Intronic
966140321 3:176749645-176749667 ATTCAAAAAGACAAGCAGGAAGG - Intergenic
966434291 3:179866093-179866115 ATTCAGAACAATCAACAGTTAGG - Intronic
967735955 3:192952828-192952850 ACTCAAAACCAGCAGCAGGCCGG + Intergenic
968329491 3:197853900-197853922 CTTGAAAACAATCATCAAGAAGG - Intronic
970943985 4:21668887-21668909 ATTGAAAACAATCCGCAAGTGGG - Intronic
971007108 4:22387775-22387797 ATTAAAAGCAATGGGCAGGAGGG - Exonic
971588445 4:28435332-28435354 ATTGAAAAAAATCAGAAGGATGG - Intergenic
971851913 4:31995111-31995133 ATTAAAAACAATCTGCAGGTTGG + Intergenic
972371043 4:38423677-38423699 ATTCAAAATAATCCGGAGAAAGG - Intergenic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
973845303 4:54905877-54905899 TTTCAAATCAAGCAGAAGGAAGG + Intergenic
974738590 4:65974653-65974675 AATGATAACATTCAGCAGGATGG - Intergenic
975250285 4:72170109-72170131 TTTCAAAAAATACAGCAGGAAGG - Intergenic
975915021 4:79314416-79314438 GTGCAAAACAATCACCTGGAGGG + Intronic
976357779 4:84139348-84139370 ATCCAAAGCAAGCAGAAGGAAGG + Intergenic
976727086 4:88225312-88225334 ATTTATAAAAATAAGCAGGAAGG + Intronic
978218386 4:106237405-106237427 CTTCAAAATCATAAGCAGGAAGG + Intronic
979244353 4:118482364-118482386 ATACAAAATAAACTGCAGGAGGG - Intergenic
979834710 4:125350430-125350452 ATTTAAAAAAATCAGCATTAAGG - Intronic
979888601 4:126062419-126062441 ATTCAAAACAAGCAGCTTTATGG + Intergenic
979977463 4:127214418-127214440 ATTCTAGACAATCATCAGGGAGG - Intergenic
983309434 4:166039328-166039350 ATTTAAAACAATCTGCAAAATGG - Exonic
983489815 4:168375423-168375445 CTTGGAAGCAATCAGCAGGAAGG + Exonic
983900696 4:173130659-173130681 ATTCAATAAAATGAGCAGGCTGG + Intergenic
984503580 4:180589546-180589568 ATTCAGAACAATAAGAAGCAAGG + Intergenic
985354196 4:189099777-189099799 AATAAAAGAAATCAGCAGGAAGG - Intergenic
987607253 5:20153230-20153252 ATTCACAAGAATCATCAGGCTGG - Intronic
987739864 5:21893657-21893679 ACTGAAAACAATCAGTAGCAGGG - Intronic
987844182 5:23260174-23260196 ATTCATCAGAATCACCAGGAGGG - Intergenic
988145785 5:27305769-27305791 ATTGAAAAAAATCAGCACGCGGG - Intergenic
988651349 5:33155117-33155139 ATTCAAAAAATTGAGGAGGAGGG + Intergenic
988820736 5:34882319-34882341 AATCTAAACCATAAGCAGGACGG + Intronic
990223373 5:53621445-53621467 ATAGAAAACAAGCAGCAAGATGG - Intronic
990327664 5:54694234-54694256 TTTGAAAACAATCAGGAGGGAGG + Intergenic
990618035 5:57527824-57527846 AATCAAAACATTCAGAAAGAGGG - Intergenic
992046232 5:72892807-72892829 ATTCACAACATTGACCAGGATGG + Intronic
992643565 5:78791599-78791621 ATTCAAAACCATGAGCAGACTGG - Intronic
993002181 5:82392344-82392366 ATTCATAACAACCAGGAGAAAGG + Intergenic
993267582 5:85745957-85745979 ATTCACAACCATAAGCAGAATGG + Intergenic
993642683 5:90424681-90424703 ACTCAAAACAATATGCAGGAGGG - Intergenic
994347696 5:98706748-98706770 ACTCAAACAAATCAGCAAGAAGG + Intergenic
994738752 5:103592011-103592033 ATTCAAAACAATGACCATTAAGG - Intergenic
995908052 5:117150137-117150159 ATTCAAAAAGATCAACAGGCTGG - Intergenic
996340194 5:122429302-122429324 ATCCAAAGCAAGCAGAAGGAAGG + Intronic
997328499 5:133042097-133042119 ATTCAAAACCACCAGGAGGTTGG - Intergenic
997958530 5:138299750-138299772 ATCCAAAGCAAGCAGAAGGAAGG + Intronic
1000842420 5:166237323-166237345 ACCCAAAACTAGCAGCAGGAAGG + Intergenic
1001019959 5:168174431-168174453 ATGCAAAACAGTCAGCACAACGG + Intronic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1002223145 5:177699304-177699326 ACTCAAAGCAAGCAGAAGGAAGG + Intergenic
1002564940 5:180106310-180106332 ACTCAAAGCCAGCAGCAGGATGG - Intronic
1003714461 6:8630869-8630891 ATTCAAAAGAAACATCAGGCTGG + Intergenic
1004565732 6:16795381-16795403 ATTCAAAGCAAACAGAAGGAAGG + Intergenic
1006585642 6:35109378-35109400 ATTCAAAATAAGCAGAAGGAAGG + Intergenic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1008305575 6:49895017-49895039 ATTCAAACCCATCAGAAGAAAGG + Intergenic
1008493023 6:52105724-52105746 ATTCAAAAGAATAAACAGCATGG - Intergenic
1009466479 6:63976654-63976676 ATACAAAGCAACCAGCATGAAGG - Intronic
1009863492 6:69366644-69366666 AATCAAGACAATTTGCAGGAAGG - Intronic
1010363337 6:75020521-75020543 ATTCAAAACATTGAGGAGGAGGG - Intergenic
1011300840 6:85872030-85872052 ACTCAAAGCTATCAGAAGGAAGG - Intergenic
1012694957 6:102367938-102367960 CTTAAAAACAATCAGAAGGAAGG - Intergenic
1012741803 6:103026204-103026226 ATTTAAAACAATTACAAGGAAGG + Intergenic
1013297066 6:108767105-108767127 ATTCAAAAGTCTCAGCAGGCTGG - Intergenic
1013534306 6:111049696-111049718 ACCCAAAGCAAGCAGCAGGAAGG - Intergenic
1014898597 6:126934534-126934556 ATTAAAAACAAGGACCAGGAGGG - Intergenic
1015049500 6:128822527-128822549 ATTAGAAACACTCAGCAGGCCGG + Intergenic
1016765484 6:147788785-147788807 ATTAAAAACCACCACCAGGACGG + Intergenic
1017845894 6:158258062-158258084 TTTCAAAACAATCAGCGGAAAGG + Intronic
1019217740 6:170454484-170454506 ACAGAAAACATTCAGCAGGATGG + Intergenic
1019500349 7:1361395-1361417 ATTAAAAATAATCATCAGGCTGG + Intergenic
1021184734 7:17550928-17550950 ACCCAAAACAAGCAGAAGGAAGG + Intergenic
1022663938 7:32391941-32391963 AGGCAAAACAAGCAGGAGGAAGG + Intergenic
1024211102 7:47205597-47205619 ATCCAAAACAAGCAGAAGGAAGG + Intergenic
1026465919 7:70654481-70654503 ATTAAAAAAAATAAGCAGTATGG - Intronic
1026727811 7:72883559-72883581 CTTCAAAACAATGAGCACGCAGG - Intronic
1027116027 7:75482166-75482188 CTTCAAAACAATGAGCACGCAGG + Intronic
1027434903 7:78154497-78154519 AATCTAAACAGTCAGCAGTAGGG - Intronic
1029108567 7:98198121-98198143 ATTCAAAGCAAGGAGAAGGAAGG - Intronic
1029149382 7:98469270-98469292 ACTAAAAACAAACAGCAGGAAGG - Intergenic
1029241844 7:99168654-99168676 ATTTAAAAAAATTAGCTGGATGG - Intergenic
1029886896 7:103882502-103882524 TTTCAAAAAAACCAGCAGGCAGG - Intronic
1029908304 7:104116589-104116611 ATTCAAAACAAGTAGGAGGAAGG - Intergenic
1030663535 7:112248993-112249015 ACACAAAAGAATCAACAGGATGG - Intronic
1031293669 7:119973549-119973571 ATTGAAAACTATTAGCAAGATGG + Intergenic
1031526457 7:122826895-122826917 ATTCAAAGCAAGCAAAAGGAAGG + Intronic
1032140393 7:129324394-129324416 ATAGAAAACAAACAGCAAGATGG - Intronic
1032314529 7:130822732-130822754 ATTCAAAACTAGCAGCTGAAAGG + Intergenic
1032656791 7:133939100-133939122 AAGCAAAAGAAACAGCAGGAAGG + Intronic
1032689515 7:134269137-134269159 ATTCCAAACAATCAGGAGGAGGG + Intergenic
1033690208 7:143728882-143728904 ATTCAAAACAAACAACAATATGG - Intronic
1034352901 7:150428856-150428878 AGTGAACACAAACAGCAGGAGGG - Intergenic
1036411035 8:8501500-8501522 ATTTAAAAAAATTAGTAGGATGG + Intergenic
1037335972 8:17792219-17792241 ATTCAATAAAAACAGGAGGAAGG + Intronic
1038189091 8:25302565-25302587 CTTCAAAACAATCAAAAGCAAGG + Intronic
1039017029 8:33161362-33161384 GTCCAAAAAAATCACCAGGATGG + Intergenic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1039418100 8:37413068-37413090 TTTGAAAACAGTCAGCATGAGGG + Intergenic
1039487786 8:37925164-37925186 ATTCAAGACAAACAGCTGAAGGG - Intergenic
1040494271 8:47952120-47952142 ATCCAAAAGAATCAACAGCAGGG + Intronic
1040875723 8:52149830-52149852 ATTCAAAACAAGCAGCATTCTGG - Exonic
1041185217 8:55292661-55292683 ATTCAAAGCAAGTAGAAGGAAGG - Intronic
1042448791 8:68920899-68920921 ATTAAAAAAAAACTGCAGGATGG + Intergenic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1044023470 8:87137776-87137798 ATTCAAAACAGTTATAAGGATGG + Intronic
1044083791 8:87917950-87917972 ATTCAAAACACACAGCAAAAAGG + Intergenic
1045550396 8:103166275-103166297 GAACAAAACAATCAGCAGGCGGG - Intronic
1045724626 8:105158119-105158141 ATGCAAAACAATCAGCTGAAGGG + Intronic
1046083803 8:109406339-109406361 ATTCAGAAGCATCAGCAGGTAGG - Exonic
1046816360 8:118588395-118588417 CATGAAAACAAACAGCAGGATGG - Intronic
1046895472 8:119467115-119467137 ATTCCAAAAAATGAGGAGGAGGG + Intergenic
1048311683 8:133327460-133327482 ATACAAAAAAATTAGCTGGATGG + Intergenic
1048406773 8:134130939-134130961 ACTCAAAACACACAACAGGAAGG - Intergenic
1049078044 8:140416024-140416046 ATTCAAAGCAAACAGAAAGAAGG + Intronic
1050664711 9:7922279-7922301 ATTCAAAACACTGAGCAGGTGGG + Intergenic
1052003190 9:23313091-23313113 ATTCAAAATAAATAGCTGGATGG + Intergenic
1054706954 9:68472354-68472376 ATCCAAAAGAATAACCAGGAGGG - Intronic
1054791203 9:69258604-69258626 ATTTAAAATAAAAAGCAGGATGG - Intergenic
1055107616 9:72528679-72528701 ATTCAGAACCTTCAGGAGGATGG - Intronic
1055119188 9:72638512-72638534 GGTCAAAATAAGCAGCAGGAAGG - Intronic
1057364209 9:94403655-94403677 ATTCAAAAGAAACAACAGCAGGG - Intronic
1057659127 9:96984416-96984438 ATTCAAAAGAAACAACAGCAGGG + Intronic
1058741037 9:107942539-107942561 AATCAAAAGAATCAGAAAGATGG - Intergenic
1059156176 9:111990284-111990306 ATTTAACACATTTAGCAGGAAGG - Intergenic
1059344458 9:113618828-113618850 ATTCAAAATAATTAACAGCAAGG - Intergenic
1059747370 9:117216223-117216245 ATCAAATACAGTCAGCAGGATGG - Intronic
1185520444 X:734604-734626 ATGCAAAACCATCATTAGGATGG - Intergenic
1187379996 X:18793053-18793075 ACCCAAAACAAGCAGAAGGAAGG - Intronic
1188091600 X:25971019-25971041 ATTCAAAACAATAAAGAGGAGGG + Intergenic
1188563537 X:31498301-31498323 TTTGAAAACAATCAGTAGGTTGG - Intronic
1190524909 X:51319252-51319274 ATTCTAAACAATGAGCAGGATGG + Intergenic
1190545323 X:51519641-51519663 ATTCTAAACAATGAGCAGGATGG - Intergenic
1190574742 X:51822554-51822576 ACTCAAAGCAAACAGAAGGAAGG - Intronic
1192540250 X:71963111-71963133 ACTCAAAACTAGCAGAAGGAAGG - Intergenic
1192540805 X:71970720-71970742 ATTCAAAGCAAGAAGAAGGAAGG - Intergenic
1192613665 X:72594268-72594290 ATTGAAAGCAAGCAGAAGGAAGG + Intronic
1192691405 X:73368727-73368749 TTTCAAAACATTAAGGAGGAGGG - Intergenic
1193100211 X:77602453-77602475 ACCCAAAACAAGCAGAAGGAAGG - Intronic
1193398754 X:81017095-81017117 ATTCCAAAAAATGAGCGGGAGGG - Intergenic
1193825203 X:86216796-86216818 ATTGAAAACAAACAGGAGGCTGG + Intronic
1193954899 X:87847930-87847952 AGTCAAAACAATCAGCACTTTGG + Intergenic
1194948373 X:100095178-100095200 ATTCCAAAAAATTAGGAGGAGGG + Intergenic
1195158432 X:102145856-102145878 AATCAAAGAAATCAGAAGGAAGG - Intergenic
1195483988 X:105381759-105381781 TTTCAAAATAATCAGAAGAATGG - Intronic
1195629491 X:107039704-107039726 ATCCAAAACCAGCAGAAGGAAGG + Intergenic
1197023715 X:121721186-121721208 ATACAAAACAAATAGCAAGATGG - Intergenic
1197374647 X:125667169-125667191 ATTCCAAAAAATGAGGAGGATGG + Intergenic
1197381699 X:125751121-125751143 ATCCAAGACTAACAGCAGGAAGG + Intergenic
1197446680 X:126558848-126558870 ATCCAAGACAAGCAGGAGGAGGG + Intergenic
1198848452 X:140939183-140939205 TTTCAAAAAATTCAGCAGGAGGG - Intergenic
1198982285 X:142412509-142412531 ATTCCAAAAAATCAGGAGGAGGG + Intergenic
1200910507 Y:8527546-8527568 ATCCAAAAGAATCAGAAGGATGG + Intergenic
1201369167 Y:13242248-13242270 TTTCAAAACACTGAGTAGGAAGG + Intergenic