ID: 949720027

View in Genome Browser
Species Human (GRCh38)
Location 3:6978211-6978233
Sequence ATGTGTAGAGGGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949720027 Original CRISPR ATGTGTAGAGGGAGGCAAGA TGG Intronic
900627225 1:3613970-3613992 AGGTGGAGAGGCAGGCAGGAAGG + Intergenic
901615262 1:10534438-10534460 ATGGGTAGAGGTAGGAAAGGTGG - Intronic
902659122 1:17889236-17889258 ATGTGTTGTGGGAGGGACGAGGG - Intergenic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903867437 1:26409891-26409913 AGGTTTGGAGGGAGGAAAGAAGG + Intergenic
904255258 1:29250652-29250674 CTGTGTTGATGGAGTCAAGAAGG + Intronic
904580543 1:31540509-31540531 GTATGTAGAGGGAGGGTAGATGG + Intergenic
904676399 1:32201574-32201596 AAATGTAGTGGGAGACAAGACGG - Intronic
904895044 1:33810916-33810938 GTGGGGAGTGGGAGGCAAGAAGG - Intronic
905003917 1:34695238-34695260 ATATGAAAAGGGCGGCAAGAGGG - Intergenic
905011937 1:34753629-34753651 GGGTGCAGAGGGAGGCATGAGGG - Intronic
905363895 1:37438431-37438453 ATGGGTAAAGGGAAGCAAGAGGG + Intergenic
906297497 1:44658201-44658223 GTGTGTAGAGGGACAGAAGAGGG - Intronic
906316679 1:44791007-44791029 GGGGGTGGAGGGAGGCAAGAAGG - Intergenic
906519059 1:46456644-46456666 AGGAGTAGAGGGAAGCAGGAGGG + Intergenic
906685727 1:47761888-47761910 ATGTGTAGAGAGAGAAAGGAAGG - Exonic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906974895 1:50559747-50559769 TTGTGAAGAGGGAGGAGAGAAGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
908005764 1:59727041-59727063 ATGTCTAGAGGGGGACAGGAGGG - Intronic
908037965 1:60076035-60076057 ATGTGACAATGGAGGCAAGAGGG + Intergenic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
908466856 1:64404653-64404675 ATGGGGAGAAGGAAGCAAGAGGG - Intergenic
908600193 1:65730597-65730619 TTGTGAAGAGAGAGGCAAGTGGG + Intergenic
909199947 1:72678484-72678506 ACTTGTTAAGGGAGGCAAGAAGG - Intergenic
909305482 1:74070475-74070497 GAGAGTGGAGGGAGGCAAGAGGG + Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
909724225 1:78814628-78814650 ATGTGTAGAGTGGGGGTAGATGG - Intergenic
911194901 1:94984398-94984420 ATGTTCACATGGAGGCAAGATGG - Intronic
911885364 1:103290887-103290909 ATGAGTTGAGTGAGGCTAGAGGG - Intergenic
912249550 1:107996824-107996846 ATGTGTATAGAGAAGCAAGAAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912665232 1:111572890-111572912 AAGAGTAGAGGGTGGGAAGAGGG - Intronic
912701568 1:111882037-111882059 AGCTGTAGAGGGAGGCAGGTGGG + Intronic
914444927 1:147741916-147741938 ATGAGTTGAGAGAGGCATGAGGG + Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915940389 1:160115137-160115159 GTTTGGAGATGGAGGCAAGAGGG - Intergenic
917135301 1:171783354-171783376 ATGAGTAGAGTGAGGAAATAGGG + Intronic
917710589 1:177680284-177680306 ATTTGTAGAGGGAGTCTGGATGG - Intergenic
917995448 1:180433993-180434015 ATGTGTAGGGTGAGGCATGGAGG - Intronic
918246190 1:182661498-182661520 AAGGACAGAGGGAGGCAAGAAGG + Intronic
918321410 1:183368673-183368695 GTGTCAATAGGGAGGCAAGAAGG - Intronic
918866943 1:189913734-189913756 ATGAGGAGAGGGAGGAGAGAGGG - Intergenic
919055573 1:192565766-192565788 AGGTGGAGAGGGAGGAAGGAAGG + Intergenic
919756167 1:201067414-201067436 AGGTGGAGAGGGAGGAGAGAGGG - Intronic
921127642 1:212191399-212191421 ATGTGTAGAGGGAGTGCTGAGGG + Intergenic
922159974 1:223072406-223072428 GTGGGTAGAGGGAGGCACCAAGG + Intergenic
922725989 1:227923291-227923313 ATGTGAAGATGAAGGCAGGAGGG + Intronic
922905115 1:229168433-229168455 CTGTGTGGGGGGAGGCAAGGGGG - Intergenic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
1062910482 10:1208816-1208838 ATTTGTCGGGGGAGACAAGATGG + Intronic
1063399314 10:5726818-5726840 ATGGGTAGAGGGAGAAGAGAGGG + Intronic
1064110366 10:12533611-12533633 AAGAGTAGAGGGAGGCAGGGTGG - Intronic
1064997937 10:21312955-21312977 ATGGGTTGATGGAGGCTAGAAGG - Intergenic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065204520 10:23344256-23344278 AGGTGTGGAGGGAAGGAAGAGGG + Intronic
1065497275 10:26342066-26342088 AGGAGTAGAGGGAGGGAGGAAGG + Intergenic
1066294300 10:34040925-34040947 ATTTTAAGAGGGAGGTAAGAAGG + Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067735302 10:48845883-48845905 CTGTGGAGTGGTAGGCAAGAGGG + Intronic
1068558258 10:58482270-58482292 ATGTGTAGGGGGAGAACAGAGGG - Intergenic
1068795099 10:61070874-61070896 ATCGGTAAAGGGAGGCAAGTTGG - Intergenic
1069138421 10:64794343-64794365 AGGTGTTGAAGGAGGGAAGAAGG + Intergenic
1069658589 10:70108523-70108545 CTGATAAGAGGGAGGCAAGAAGG - Intronic
1070960199 10:80493797-80493819 ATGTGCAGAGGAAGGGAAGCTGG + Intronic
1071824888 10:89315770-89315792 ATGTTTAGTGTGAGGCAAAAAGG + Intronic
1072421667 10:95294938-95294960 ATGAGAAGAGGGAAGCAAGGAGG + Intergenic
1073844423 10:107537577-107537599 AAGTGTGGAGGGAGGTAAGATGG - Intergenic
1074007237 10:109439700-109439722 ATGTGTTGAGGGAGGGACCAGGG - Intergenic
1074162404 10:110845586-110845608 ATGGGTAGGGGGAGGGAAGGTGG - Intergenic
1074708075 10:116153310-116153332 ATGTATAAAGGGAGGAAGGATGG - Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075674921 10:124289755-124289777 GGGTGTGGAGGGAGGCAAGGAGG - Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1078024213 11:7679427-7679449 ATGTGTAGAGGGAAACAGGGAGG + Intergenic
1078518915 11:12047849-12047871 ATTTGTTGAGGGAGGCTAGGTGG + Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081781829 11:45718424-45718446 AGGAGTAGAAGGAGGCAGGAAGG - Intergenic
1082065976 11:47900647-47900669 AAGTCTAGAGGGAGGCCAGGCGG + Intergenic
1083149493 11:60783211-60783233 ATGTGGAGAGAGAAGCCAGATGG + Intergenic
1083181929 11:60992354-60992376 ATGAGGTGAGGGAGGCAAGGGGG + Intronic
1083516504 11:63263640-63263662 ATGGGCAGAGGGGGCCAAGATGG - Intronic
1084363962 11:68685743-68685765 AGGTCAAGAGGGAGGCCAGAGGG - Intronic
1084692594 11:70735720-70735742 ATGTGCAGAGGGAGGGAAGTGGG + Intronic
1084852915 11:71958209-71958231 ATGTGTAGAAGAAGGCAACCTGG + Intronic
1085464145 11:76712903-76712925 ACGGGTACAGGGAGGCAGGAAGG - Intergenic
1087214578 11:95481801-95481823 GTGGGGAGAGGGAGACAAGAGGG - Intergenic
1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG + Intergenic
1089110304 11:116050597-116050619 ATGTGATGAGGTAGGCATGAGGG - Intergenic
1089295436 11:117464582-117464604 AGGTGTAGAGGGAAGAGAGAGGG + Intronic
1089545861 11:119224881-119224903 AGGTGGAGCGGGAGGCAAGGGGG + Intronic
1089733726 11:120535364-120535386 GTGTGAAGGGGGAGGTAAGAGGG + Intronic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091136873 11:133199200-133199222 GTGGGGAGAGGGTGGCAAGAGGG + Intronic
1093210576 12:16303354-16303376 TTGAGAAGAGGGAGGAAAGAAGG + Intergenic
1095566746 12:43633437-43633459 AAGTGTTGAGGGAGTTAAGAAGG - Intergenic
1095625520 12:44309545-44309567 AGGAGTTGAGGGAGGGAAGAAGG + Intronic
1096164179 12:49407089-49407111 ATATGTAGAGAGAGGCATCAAGG - Intronic
1096790404 12:54040973-54040995 ATGTGGAGAGTGAGGAAAGTCGG - Intronic
1096862570 12:54540391-54540413 ATGTGTTTGGTGAGGCAAGAGGG + Intronic
1099798118 12:87423110-87423132 ATGAGGAGAGGCTGGCAAGATGG - Intergenic
1101057869 12:100937877-100937899 TTAAGAAGAGGGAGGCAAGAAGG - Intronic
1101993232 12:109504695-109504717 ATGAGCAGAGGGAGGAGAGAAGG + Intronic
1105234893 13:18541187-18541209 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1105335183 13:19460501-19460523 ATGTTTAGAGTGATGCAAGATGG - Intronic
1105859735 13:24398885-24398907 ATGTTTAGAGTGATGCAAGATGG + Intergenic
1106312667 13:28567528-28567550 AGGTGAAGATGGAGGAAAGATGG + Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1107729825 13:43337585-43337607 ATGTGTGGAGGTAGGAAAGAGGG + Intronic
1108518062 13:51221568-51221590 GGGTGAAGAGGGAGGCAAGTTGG - Intergenic
1108629723 13:52269562-52269584 ATGTTTAGAGTGATGCAAAATGG - Intergenic
1109517010 13:63456857-63456879 ACGACTAGAGGGAGGAAAGAAGG - Intergenic
1112389058 13:98966133-98966155 ATGAGGAGAGGAAGACAAGACGG + Intronic
1113420087 13:110164551-110164573 ATCTGGAGCGGGAGGCAGGAGGG + Intronic
1114498213 14:23148597-23148619 CTTTCAAGAGGGAGGCAAGAAGG + Intronic
1114513936 14:23285709-23285731 CTGTGTAGGGGAGGGCAAGAAGG - Intronic
1119125812 14:72125398-72125420 ATGTGAAGAAGGAGGCATGGGGG - Intronic
1119324761 14:73753223-73753245 ATCTGGAGAGGGAGGCAGCAGGG + Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG + Intergenic
1119851545 14:77870027-77870049 ATGGGTAAAGGCAGACAAGATGG + Intronic
1121894508 14:97634014-97634036 ATTTGTGGAGGGAGGGAGGAAGG + Intergenic
1123706570 15:22955269-22955291 ATGAGTGGAGGGAGGCTGGATGG + Intronic
1124068129 15:26365190-26365212 ATATGCAGAGAGAAGCAAGAGGG - Intergenic
1124153107 15:27199972-27199994 AGGAGTAGAGGGAGGAAGGAAGG - Intronic
1127870415 15:63068295-63068317 ATGTGTATTTGGAGGCAACAAGG + Intronic
1128001577 15:64197628-64197650 AGATGTAGAGGGAGTCTAGATGG - Intronic
1128773479 15:70301372-70301394 ATGACAAGAGTGAGGCAAGATGG - Intergenic
1129234268 15:74214345-74214367 GTGAGTGGAGGGAGGCAGGAAGG - Intergenic
1129291814 15:74574085-74574107 ATGTGCAGAGTGAGGAGAGAAGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129949194 15:79571253-79571275 ATGTAGAGAGGGAGGGAAGGGGG - Intergenic
1130092612 15:80833591-80833613 ATGGGCAGAGGCAGTCAAGATGG + Intronic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1132025720 15:98402990-98403012 ATGTGCAGAGGGAGGTCATATGG - Intergenic
1132955718 16:2592296-2592318 CTGTTTTGAGGGAGCCAAGATGG + Intronic
1133351288 16:5102342-5102364 ATGTGATGAGGGAGGAGAGATGG + Intergenic
1133372349 16:5254861-5254883 ATGTGTAGGTGGAGCGAAGAGGG + Intergenic
1134411085 16:14003673-14003695 AAGTGTAGAGGAAGGAAGGAAGG - Intergenic
1134729416 16:16448689-16448711 ATGGGTAGACGGAGGAAAGCAGG - Intergenic
1134766805 16:16766343-16766365 ATGTATAGAGAGAGGCAGCAAGG + Intergenic
1134834965 16:17353648-17353670 ATGGGTAGAGAGATGCATGATGG - Intronic
1134938019 16:18263161-18263183 ATGGGTAGACGGAGGAAAGCAGG + Intergenic
1136709707 16:32226790-32226812 ATGCTTGGAGGGAAGCAAGAAGG - Intergenic
1136758202 16:32702621-32702643 ATGCTTGGAGGGAAGCAAGAAGG + Intergenic
1136809906 16:33167754-33167776 ATGCTTGGAGGGAAGCAAGAAGG - Intergenic
1136816382 16:33277834-33277856 ATGCTTGGAGGGAAGCAAGAAGG - Intronic
1136860563 16:33699080-33699102 ATTTGGAGAGGAAGGAAAGAAGG - Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1139139689 16:64246202-64246224 AAGTGTGGAGGGAGGAAGGAGGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140609118 16:76577061-76577083 TTGTATAGAGGAAGGCAAGTGGG + Intronic
1141344081 16:83229330-83229352 ATGTGTAGAGGGAAACTTGAAGG - Intronic
1203060353 16_KI270728v1_random:962970-962992 ATGCTTGGAGGGAAGCAAGAAGG + Intergenic
1203122063 16_KI270728v1_random:1547263-1547285 ATTTGGAGAGGAAGGAAAGAAGG - Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143299386 17:5898491-5898513 AAGTCTTGAGGAAGGCAAGAGGG + Intronic
1143370009 17:6433748-6433770 ATGTGAAGATGGAGGGAACAAGG - Intronic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1145263095 17:21366299-21366321 CTAAGTAGAGGGAGGCAAGAGGG - Intergenic
1147337999 17:39738577-39738599 AGGTGTACAGGGAGGGAACAAGG - Intronic
1147546754 17:41407919-41407941 ATGGGTAGTGGGAGCCAAGCTGG + Intergenic
1148857587 17:50587193-50587215 AGATGTAGAGGGAGGCACAACGG + Intronic
1149042370 17:52205294-52205316 ATGTGTAGAGTCAGAGAAGAAGG - Intergenic
1149495933 17:57117460-57117482 GTGTGTAGAGGGTGGCGAAATGG + Intronic
1151535023 17:74734249-74734271 AGGTGAAGACAGAGGCAAGATGG - Intronic
1151653023 17:75481591-75481613 ATGTGTGGAGACAGGCAGGAAGG + Intronic
1152038664 17:77889317-77889339 GTTTGTATAGGGAGGCAGGACGG - Intergenic
1152355629 17:79805780-79805802 ATGGGTAGGGGGAGGAAAAATGG + Intergenic
1152788015 17:82261890-82261912 ATGGTTTGAGGGAGGGAAGAGGG - Intronic
1153671286 18:7414926-7414948 ATGTGCAGAGAAAGACAAGAAGG + Intergenic
1154514645 18:15148686-15148708 ATGGATAAAGGGAGGCAAGTGGG + Intergenic
1155758336 18:29530762-29530784 ATGGGGAAAGGGAGGTAAGAAGG + Intergenic
1156218381 18:35026305-35026327 ATCTGGAGAGGGAGCCAAGTAGG + Intronic
1156895327 18:42239729-42239751 CTGGGTAGAGAGAGGCAAGCGGG - Intergenic
1157443197 18:47725720-47725742 ATGTGTATAAGGAGGCTGGAGGG - Intergenic
1157552162 18:48589362-48589384 ATGTGAAGATGGAGGCAGGCAGG - Intronic
1157695873 18:49723194-49723216 TTGTGTACAGGGAGCCAGGAAGG - Intergenic
1157838682 18:50933806-50933828 AAGGGTAGAGGGCGGGAAGAGGG - Intronic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158314651 18:56197934-56197956 ATGGGTGGAAGGTGGCAAGAGGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159680347 18:71342679-71342701 GTGTGTAGAGAGAAACAAGAAGG - Intergenic
1160709562 19:544806-544828 ATGGGTAGAGGGATGGATGATGG - Intronic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163736240 19:18982786-18982808 TTGTTTACAGGCAGGCAAGATGG - Intergenic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1166145054 19:40828372-40828394 CTTTTTAGAGGGAGGCAGGAGGG + Intronic
1166691299 19:44822571-44822593 AGATTTAGGGGGAGGCAAGAGGG + Intergenic
1167094347 19:47366227-47366249 CTGTGCAGAGGCAGGCAAGGAGG - Intronic
926448216 2:12970445-12970467 TTATAAAGAGGGAGGCAAGAAGG + Intergenic
926983201 2:18593535-18593557 GTGGGGAGAGGGAGGAAAGAAGG - Intergenic
927230917 2:20823363-20823385 ATGGGAAGAGGGAGAAAAGAGGG - Intergenic
927679372 2:25129934-25129956 ATGGGTAGAGGGTGGCATGCAGG - Intronic
927861031 2:26560026-26560048 ATATCTAGAAGGAGGAAAGAAGG - Intergenic
929028914 2:37632777-37632799 ATGTGTAGATTGAGGCCAGAAGG + Intergenic
929031585 2:37654280-37654302 ATGTTCAGAGGGAGGCAAATGGG + Intronic
929266293 2:39922204-39922226 ATGTGAAGAAGTAGGAAAGATGG - Intergenic
929794041 2:45044912-45044934 ATGTGTAAAGAGGGGCAAGATGG + Intergenic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
931172868 2:59823304-59823326 ATGAGAAGAGTGAGGGAAGAAGG - Intergenic
931479243 2:62622722-62622744 ATGTTTAGAGACTGGCAAGATGG - Intergenic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932661059 2:73652444-73652466 ATGGGTAGAGGGGAGCAACAAGG + Intergenic
933726323 2:85429646-85429668 AGGGGTAGAGAGAGACAAGAGGG - Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934613958 2:95760055-95760077 ATGAGTAGATGGATGCTAGATGG + Intergenic
935013449 2:99157150-99157172 ATGTGCAGAGTGTGGCAGGATGG - Intronic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936985508 2:118308684-118308706 AGGAGAAGAGGGAGGGAAGATGG + Intergenic
937444234 2:121943335-121943357 ATTTGTAGGGTGAGGTAAGAGGG + Intergenic
937696211 2:124811307-124811329 ATGTGAGGAGGAAGGCGAGAGGG + Intronic
938514898 2:131993450-131993472 ATGGATAAAGGGAGGCAGGAGGG + Intergenic
939623246 2:144446396-144446418 ATGTGGAGAGGGAAGAAGGAGGG - Intronic
939637260 2:144597493-144597515 ATGTAGACAGGGAGGCAGGATGG + Intergenic
941111350 2:161421735-161421757 AGAAGTAGAGGGAGGCAGGAAGG - Intronic
942157075 2:173140715-173140737 ATGTGAAGAGGGTGGCATGAGGG + Intronic
944050639 2:195464897-195464919 ATGTGCACAAGGAGGCAAGGAGG + Intergenic
946235895 2:218324106-218324128 AGGGGTAGAGGGAGGCAGGAGGG - Intronic
947434372 2:230060297-230060319 ATGAGAGGAGGGAGGCTAGATGG + Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948072720 2:235140664-235140686 ATGGGCAGAGGGAGGCAGAAGGG - Intergenic
948272227 2:236683445-236683467 AGGGGAAGAGAGAGGCAAGATGG - Intergenic
1169112043 20:3040505-3040527 GAGTGAAGAGGGAGGCATGAAGG - Intergenic
1169181080 20:3567724-3567746 AGGTTTTGAGGGAGGCAGGAAGG + Intronic
1169637901 20:7714980-7715002 ATGGGTGGAGGGAGGCAGGGAGG + Intergenic
1169855872 20:10102243-10102265 AGGTGGAAAGGGAGGCAAGAGGG - Intergenic
1170387677 20:15837569-15837591 ATGTGTAGAATGCGGCAAGTTGG - Intronic
1170593362 20:17787620-17787642 GGGTGTGGAGGGAGGCAAGCAGG - Intergenic
1170813916 20:19696952-19696974 AGGAGGAGAGGGAGGGAAGAAGG + Intronic
1171033773 20:21700447-21700469 ATTTGTGAAGGGAGGCGAGAGGG - Intergenic
1172593788 20:36135625-36135647 ATATGTAGAGGGAAGCAGGAAGG - Intronic
1173803693 20:45910917-45910939 AAATGTAGAGGGGGCCAAGAAGG - Intronic
1174848417 20:53967148-53967170 ATGTGGACAGGGGGGCAACAAGG - Intronic
1174872881 20:54199874-54199896 ATGAGGAGTGAGAGGCAAGAAGG - Intergenic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176738392 21:10574485-10574507 ATGTTTAGAGTGATGCAAGATGG + Intronic
1176778885 21:13169465-13169487 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1177976530 21:27858616-27858638 ATGGATAAAGGGAGGCAGGAGGG - Intergenic
1178323287 21:31622534-31622556 GTGTCTACAGGGAGGAAAGAGGG - Intergenic
1178998085 21:37425833-37425855 TTGTGCAGAAGGAGGCATGAGGG + Intronic
1179368218 21:40779239-40779261 GAGAGTAGAGAGAGGCAAGACGG + Intronic
1181625471 22:24119659-24119681 AGGTGTAGAGGAAGGCCAGACGG - Exonic
1183479274 22:38054118-38054140 ATGAGCAGAGGGGGTCAAGAGGG - Intergenic
1185151615 22:49167146-49167168 AGGGGTGGAGGGAGGGAAGAAGG - Intergenic
949170737 3:993270-993292 ATGTGTAGAGCTAGACAACATGG + Intergenic
949720027 3:6978211-6978233 ATGTGTAGAGGGAGGCAAGATGG + Intronic
949743743 3:7264709-7264731 ATGTGGAGAGGTAGGCAAGATGG - Intronic
950235847 3:11319623-11319645 AGGTGCAGAAGGAGGCAAGCAGG - Intronic
951446965 3:22793831-22793853 ATGTGTATAGGAAAGCAATAAGG + Intergenic
952346939 3:32496924-32496946 ATGTTTAGATGAAGGCAGGAGGG + Intronic
952528133 3:34234535-34234557 ATTTGGAGGGTGAGGCAAGAGGG - Intergenic
953388886 3:42523149-42523171 ATCTGTAGAGGGGGACATGAAGG - Intronic
953474001 3:43190617-43190639 ATCTGGAGACGGAGGTAAGAGGG - Intergenic
954284622 3:49610042-49610064 GTGTGTAGAGGAAAGCCAGATGG + Intronic
955137471 3:56233881-56233903 AAGTGAAGAGTGAGGCAAGAGGG - Intronic
955142156 3:56280060-56280082 TTGATAAGAGGGAGGCAAGAGGG + Intronic
955867071 3:63396400-63396422 ATGTCTAGGGGGAGGAAGGAGGG + Intronic
956391028 3:68772701-68772723 ATGGGTAGAGGGAGGGGAGCTGG + Intronic
959299112 3:104576637-104576659 AGGTGTAGCTGGGGGCAAGATGG + Intergenic
959504623 3:107144083-107144105 ATTGGTTGAGGGAGCCAAGATGG + Intergenic
959932096 3:111996280-111996302 GTGGATAGAGTGAGGCAAGAGGG - Intergenic
961783548 3:129335925-129335947 ATGTGTAGAGGGGTGGCAGAGGG + Intergenic
962459917 3:135601183-135601205 ATTCTTAGAAGGAGGCAAGATGG + Intergenic
962698557 3:137974716-137974738 ATATGTTGAGAGAGACAAGATGG - Intergenic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963545266 3:146649460-146649482 ATTTGTAGAGAGGGGCAAAATGG + Intergenic
965419212 3:168436402-168436424 GTGTGTTGAGGGAGGAAGGAGGG - Intergenic
965752760 3:171993595-171993617 ATGAGTAGAGAGATGCAGGAGGG - Intergenic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966073948 3:175913203-175913225 ATATGAAGAAGGAGGCCAGAAGG + Intergenic
966088880 3:176106097-176106119 ATGTGTAGATGGGGGTAAGAAGG + Intergenic
967557369 3:190875724-190875746 CTGTGCAGAGGCAGGCAAGGAGG - Intronic
967845678 3:194040847-194040869 ATGTGGAGAAGCAGCCAAGAGGG + Intergenic
968262337 3:197335388-197335410 GTGGGGAGTGGGAGGCAAGAGGG + Intergenic
969479657 4:7441181-7441203 AGGTGAAGAGTGAGGCTAGAAGG + Intronic
969981476 4:11160754-11160776 ACATGTAGAGGGAGTTAAGATGG + Intergenic
971608644 4:28692107-28692129 ATGTGTAGAGGCAGGAGATAAGG - Intergenic
972374654 4:38459193-38459215 ATGTATGGAGGGAGGAGAGAGGG + Intergenic
972889741 4:43542311-43542333 ATGGAGAGAGGGAGGAAAGAAGG - Intergenic
972933941 4:44107935-44107957 ATGTTTAGAGGGAGGTCTGAGGG + Intergenic
973685608 4:53366525-53366547 ATGAGATGAGGGAGGAAAGATGG - Intergenic
974754390 4:66184446-66184468 ATGTGAAGAGGAAGGCAACATGG + Intergenic
974825133 4:67118688-67118710 AAGGGTAGAGGGTGGGAAGAGGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976382247 4:84412810-84412832 TGGGGTAGAGGAAGGCAAGAAGG + Intergenic
976669240 4:87633635-87633657 ATGTGTGAAGGGAGGAAAAAGGG - Intergenic
978488895 4:109289258-109289280 ATGTACAAAGGGAGGCAAAACGG - Intronic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978698817 4:111617580-111617602 ATGTGTATGGGGAGGCAAGGAGG + Intergenic
979216792 4:118174867-118174889 CAGTGGAGAGGCAGGCAAGAAGG - Intronic
981747051 4:148062133-148062155 TTGTGTATAGGGAGACAAGTGGG + Intronic
982231328 4:153210917-153210939 ATGTGTTGAGTGTGGGAAGAGGG - Intronic
982331979 4:154191231-154191253 ATGTGTGGGGGCAGGAAAGATGG - Intergenic
982560183 4:156920029-156920051 ATGGGGAGAGGGGAGCAAGATGG - Intronic
982837025 4:160131513-160131535 ATGGGTAGAGAGAGGCAAGGTGG - Intergenic
983562842 4:169118173-169118195 ATGTGGAGCTGGAGGCAAGTAGG - Intronic
984861112 4:184239710-184239732 GTATGTAGAGGGAAGTAAGATGG + Intergenic
984906338 4:184630286-184630308 ATGTGGAGTGGGAGAAAAGAAGG - Intronic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986517685 5:8581069-8581091 ATGTTAAGAGGGAGGCAGGTGGG - Intergenic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
987043306 5:14083410-14083432 AGGGGCAGAGGGAGGCAATAGGG - Intergenic
987204455 5:15610589-15610611 AAGTGGAGAGGGAGGCAGGGAGG - Intronic
987492568 5:18599151-18599173 ATCTCTAGAGGGACACAAGATGG + Intergenic
987576778 5:19738734-19738756 ATGGGCAGAGGGTGGGAAGAGGG + Intronic
988498459 5:31764480-31764502 ATGTGTACAGGAGGGCAGGAGGG - Intronic
988556672 5:32242548-32242570 ACGTGTAGAGAGAGACAAAAAGG - Intronic
988681964 5:33492247-33492269 ATGTGAAGCTGGAAGCAAGATGG + Intergenic
990866708 5:60388065-60388087 ATGTGTAGGGTGAGGTATGAGGG + Intronic
991583787 5:68182580-68182602 GAGAGTAGAGGGTGGCAAGAGGG - Intergenic
992735115 5:79711935-79711957 ATGCGAAGAGGGAGTGAAGATGG - Intronic
992744089 5:79802186-79802208 ATATGAAGAGGAAGGAAAGAAGG - Intergenic
993821026 5:92617181-92617203 ATGGGTAGAAGGTGGGAAGAAGG - Intergenic
994953662 5:106498734-106498756 AAGTGTAGAGGAAGGGAAGCAGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
998541015 5:142981715-142981737 AAGTGAAGAGGGAGACAGGAAGG - Intronic
1000576306 5:162979489-162979511 ATGTGAAGAGGGAGTAAAAATGG + Intergenic
1000677870 5:164144163-164144185 TTGGGTAGAGAGAGGCAAGTTGG - Intergenic
1001089386 5:168726335-168726357 AGGTGGAGAGGGAGGCAGGGAGG + Intronic
1001820436 5:174705952-174705974 ATGTGTGGAGAGAGGCAGGGAGG - Intergenic
1002815066 6:672047-672069 ATGTATAGTGGGAACCAAGAAGG - Intronic
1003727611 6:8783040-8783062 GTTTGTAGAGGGAAGCAAAAAGG + Intergenic
1003746332 6:9006558-9006580 TTTTGAAGAGGAAGGCAAGAGGG + Intergenic
1003783424 6:9455919-9455941 ATGTAGAGAGGGATGGAAGAGGG + Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005436094 6:25813717-25813739 CTGGGTAGAGGGTGGGAAGAGGG - Intronic
1005739462 6:28776732-28776754 ATGGGAAGGGGGAGGAAAGAGGG - Intergenic
1006136548 6:31899633-31899655 ATATGTGGAGGGAGGGAAAAGGG - Exonic
1006425573 6:33960879-33960901 ATGTGGGGAGGGAGACAGGAGGG - Intergenic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009488331 6:64254147-64254169 ATGGGTACAGTGAGGCAAGAGGG - Intronic
1009960572 6:70515840-70515862 ATGTGTAGGGGTGGGGAAGAGGG + Intronic
1010097334 6:72062360-72062382 ATGGAAAGAAGGAGGCAAGAAGG - Intronic
1010363210 6:75018864-75018886 GTGAGGAGAGGGAGGCAGGATGG - Intergenic
1010533290 6:76992505-76992527 AGGTGGATGGGGAGGCAAGAAGG - Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012818288 6:104052894-104052916 ATGAGTAGGGGGAGGAAGGAAGG + Intergenic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015382117 6:132581400-132581422 AGGGAAAGAGGGAGGCAAGAGGG + Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1016070515 6:139733067-139733089 ATGGGGAGAGGGAAGCAGGAAGG + Intergenic
1016298038 6:142597091-142597113 AAGAGAAGAGGGTGGCAAGAAGG + Intergenic
1017041004 6:150308797-150308819 ATGAGGAGAGGAAGGAAAGAAGG + Intergenic
1018204926 6:161428345-161428367 AGGGGCAGAGGGAGGCAGGACGG + Intronic
1018434772 6:163750263-163750285 AAGTGTAATGGGAGCCAAGATGG - Intergenic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018698376 6:166407959-166407981 ATTGGAAGAGGGAGGCAGGAGGG + Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1020836850 7:13164380-13164402 ATTTGTAGGGGGAGGAAAAAAGG - Intergenic
1021672641 7:23047363-23047385 ATGGGGAGAGGGAGACGAGAGGG + Intergenic
1022241724 7:28518658-28518680 ATGGCTAGAGGGAAACAAGATGG + Intronic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022872116 7:34490499-34490521 AAGTATAGAGGCAGGAAAGAAGG - Intergenic
1023328914 7:39091974-39091996 ATGTGAAGAGGAAGGGTAGAAGG + Intronic
1024152454 7:46586471-46586493 ATCTGTAGTTGGAGTCAAGAAGG + Intergenic
1024167253 7:46747253-46747275 GTGTCTAGAGGGAGGAAGGAGGG - Intronic
1025034730 7:55587074-55587096 ATGTGTTCAGGGGAGCAAGATGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1027601526 7:80246343-80246365 AGGAGTAGTGTGAGGCAAGAGGG + Intergenic
1029337788 7:99917048-99917070 GTGAGTAGAGGTAGGAAAGAAGG - Intronic
1030551309 7:110963937-110963959 ATGTGTAGAGGGAGGGGACCTGG + Intronic
1031368741 7:120937504-120937526 AGGGGAAGAGGGAGGCAGGAAGG + Intergenic
1031589942 7:123578436-123578458 ATAAGTAGAAGGAGGAAAGAGGG - Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032719816 7:134541697-134541719 ATGAGTGGAGACAGGCAAGAAGG - Intergenic
1032817452 7:135491343-135491365 ATGTTTAGAGGTAGGCAAAAAGG + Intronic
1033733302 7:144198779-144198801 ATGTGTAAAGGTGGTCAAGATGG + Intergenic
1033749748 7:144352194-144352216 ATGTGTAAAGGTGGCCAAGATGG - Intergenic
1034453032 7:151148028-151148050 CTTTGTAAAGAGAGGCAAGATGG + Intergenic
1037552278 8:19986098-19986120 TTGTGCATAGGGAGGCAAGGTGG + Intergenic
1038013129 8:23490577-23490599 TTTTTAAGAGGGAGGCAAGAAGG + Intergenic
1038024155 8:23574150-23574172 TTGGTTAGAGGGATGCAAGAAGG + Exonic
1038368982 8:26969171-26969193 TTGTGTAGTGAGAGGCAAGGAGG + Intergenic
1038395129 8:27241015-27241037 ATGCTGAGAGGGAGGAAAGAAGG + Intronic
1039320096 8:36420045-36420067 ATGAGTTGAGGGAGAGAAGAAGG + Intergenic
1042307529 8:67346925-67346947 ATTTGTAGAGATAGGCTAGATGG + Intergenic
1042663259 8:71178821-71178843 ATGAGGAGAGGGATCCAAGAGGG - Intergenic
1044474696 8:92612403-92612425 ATGTCTCTAGGGTGGCAAGAGGG + Intergenic
1044499519 8:92936463-92936485 ATGAACAGAGGGAGGCAGGAAGG + Intronic
1044581487 8:93830276-93830298 ATGTGTAGGGTGAGGCATGGGGG - Intergenic
1044888344 8:96804307-96804329 ATTTTTAGAGTGAGGAAAGAAGG + Intronic
1045507447 8:102788813-102788835 AGGTGAACAGGGAGGGAAGAGGG - Intergenic
1045871539 8:106933002-106933024 ATTTGTAGTGGGAGGAGAGATGG - Intergenic
1045879367 8:107020285-107020307 ATATGGAGACGTAGGCAAGATGG + Intergenic
1047298093 8:123588872-123588894 AAGTGTAGAAGGAGCCAAGGTGG + Intergenic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1048043089 8:130749489-130749511 AGGCTTACAGGGAGGCAAGAGGG + Intergenic
1048164909 8:132053897-132053919 CTGTGTTGAGGGAGCCAACATGG + Intronic
1048267049 8:132996945-132996967 AGTTGGAGAGGTAGGCAAGAAGG + Intronic
1048637256 8:136310614-136310636 AAGTGTAGAGAGATCCAAGAAGG - Intergenic
1049042119 8:140120502-140120524 ATGGATAGATGGAGGCTAGATGG - Intronic
1049414534 8:142489180-142489202 ATGTGAAGGGGGAGGCCAGGGGG + Intronic
1050394685 9:5183264-5183286 ATATGTAGAGGAAGGAAAAATGG - Intronic
1050871283 9:10573478-10573500 TTGTATGGAGGAAGGCAAGATGG + Intronic
1051130679 9:13856600-13856622 CTGTGAAGAGGTAGGAAAGATGG - Intergenic
1055200808 9:73658976-73658998 ATGTGAAGAAGGAAGCAAAATGG + Intergenic
1056246465 9:84700391-84700413 ATGTGTGGTGGGAGGAGAGAAGG + Intronic
1056780381 9:89544598-89544620 ATCTGGAGAGGGAGGCAGGTAGG - Intergenic
1057617246 9:96602665-96602687 ATGTGTAGTGGGAGGGACGCTGG - Intronic
1057906538 9:98987791-98987813 ATCCTTAGAGGGAGGGAAGAAGG - Intronic
1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG + Intronic
1059060890 9:111034775-111034797 ATGGGGATAGGGAGGCAAGGAGG - Intronic
1060685362 9:125606192-125606214 ATGTTTAGAGGAAGGCAGGGAGG + Intronic
1061507793 9:131041430-131041452 ATGTGTGGTGGGTGGGAAGATGG + Intronic
1061546932 9:131309797-131309819 ATGGGTGGAGGGAGCCAGGAAGG + Intergenic
1061681022 9:132242454-132242476 AAGTGTGGTGGGAGGCAGGACGG - Exonic
1185497379 X:565747-565769 ATGGGTAGATGGATGCATGATGG + Intergenic
1185755150 X:2647370-2647392 ATGGAAAGAGGGAAGCAAGAGGG - Intergenic
1185835257 X:3339717-3339739 ATTTTTAGAAGGATGCAAGAAGG - Intronic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186754711 X:12658374-12658396 ATGCATAGAGGCAGGAAAGAAGG + Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1188327526 X:28823789-28823811 ATGTGATCAGGGAGGCAAGAAGG - Intronic
1188645232 X:32558302-32558324 GTATGTAGAGGAAGGCCAGATGG - Intronic
1190290774 X:48990797-48990819 ATGGGGTGAGGGAGGCAGGAGGG - Intronic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1192699101 X:73448419-73448441 AAGTGTTGAGGCAGGCGAGAAGG + Intronic
1194717671 X:97305856-97305878 ATGGGAAATGGGAGGCAAGAAGG + Intronic
1194801859 X:98283671-98283693 GTGTGTAGAGGAAGGAAAGAAGG - Intergenic
1194933018 X:99912225-99912247 GTGTGTAGTGGCAGGCAGGATGG - Intergenic
1195208742 X:102629970-102629992 ATTAAAAGAGGGAGGCAAGAAGG - Intergenic
1195436017 X:104843840-104843862 ATGTTTGGAAGGAGCCAAGATGG - Intronic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195604338 X:106785492-106785514 ATGTGACAAGGGAAGCAAGAGGG + Intronic
1196814931 X:119657454-119657476 ATGTCTAGAGGGGGACAAGGAGG - Intronic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197731101 X:129810785-129810807 AGGTGTAGAGGCAGGGAAGCTGG + Intronic
1198773816 X:140158339-140158361 ATATGGAGAGGGAGGCAAGGAGG + Intergenic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1201799910 Y:17944176-17944198 ATATGTATACGGAGCCAAGATGG + Intergenic
1201801643 Y:17961780-17961802 ATATGTATACGGAGCCAAGATGG - Intergenic