ID: 949724282

View in Genome Browser
Species Human (GRCh38)
Location 3:7025393-7025415
Sequence CTGCCATGTGAAGACGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949724277_949724282 23 Left 949724277 3:7025347-7025369 CCGCCAGGAAGAAATAATAAAAT 0: 1
1: 1
2: 5
3: 65
4: 733
Right 949724282 3:7025393-7025415 CTGCCATGTGAAGACGTTAAGGG 0: 1
1: 0
2: 1
3: 7
4: 97
949724278_949724282 20 Left 949724278 3:7025350-7025372 CCAGGAAGAAATAATAAAATAGA 0: 1
1: 0
2: 10
3: 82
4: 943
Right 949724282 3:7025393-7025415 CTGCCATGTGAAGACGTTAAGGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949724282 Original CRISPR CTGCCATGTGAAGACGTTAA GGG Intronic
900700594 1:4046505-4046527 CTGCAATGTGAAGCCCTTAGTGG + Intergenic
907145517 1:52227281-52227303 CTCCCATGTGAAAAGGCTAAAGG - Intronic
908033326 1:60025173-60025195 CTGCCATGTGAAGATACAAAAGG - Intronic
911109682 1:94169413-94169435 CTGGCATGTCAAGAGGTTGAGGG + Intronic
911271725 1:95809906-95809928 ATGCCATGTGAACAAGTGAAAGG - Intergenic
911553558 1:99314583-99314605 CTGCCACCTGAAGACTATAAGGG - Intergenic
911585755 1:99688849-99688871 CTGCCATCAGATGACTTTAAAGG + Exonic
915924646 1:160006649-160006671 CTGCTAAGTGAAGGCTTTAATGG - Intergenic
918668342 1:187179638-187179660 CTGCCATGTGAAGAAGGTGCTGG - Intergenic
918977614 1:191511155-191511177 CTGCCATGTGAATAAATTGAAGG + Intergenic
920725463 1:208430624-208430646 CTGCCATGTGAAGAAGTTTCTGG + Intergenic
921155373 1:212434194-212434216 CTGGGATGTGAGGATGTTAAGGG + Intronic
922133266 1:222800010-222800032 CTGAGATGTGAAGAACTTAATGG - Intergenic
1063457695 10:6195840-6195862 CTGCCATGAGAATAAGTGAATGG - Intronic
1064692226 10:17929962-17929984 CTGACATGTGTAGAAGTCAAAGG - Intergenic
1065129408 10:22605312-22605334 CTCTCATGTGAAGAGTTTAACGG + Intronic
1065928358 10:30456544-30456566 CTGCCATGTGAATAAGAGAATGG - Intronic
1068579044 10:58718268-58718290 CTACCATGTGAAGACATAGAAGG - Intronic
1071116672 10:82229611-82229633 CTGCCATGTGAAGAAGGACATGG - Intronic
1078479132 11:11660809-11660831 CTGCCATGTGTGGATGTTAGTGG - Intergenic
1081516717 11:43838972-43838994 CAGTAATGTGAAGAGGTTAATGG - Intronic
1090346448 11:126075491-126075513 CTGCCATGTGAAGACACAGAAGG + Intergenic
1094794709 12:33957966-33957988 TTGCCAGGTAAAGAAGTTAAAGG - Intergenic
1095106562 12:38240593-38240615 TTGCCAGGTAAAGAAGTTAAAGG - Intergenic
1101131389 12:101694580-101694602 CTGTCATGTGAAGACATAGAAGG + Intergenic
1101423434 12:104567871-104567893 CTGCCATGTGAAGACACAGAAGG + Intronic
1104897396 12:132171141-132171163 CTACGATGTGGAGACGTTGACGG + Intergenic
1110540107 13:76698508-76698530 CTGCCATGTGAATACGATTGAGG - Intergenic
1112689092 13:101869519-101869541 CTGCCATGGAAATACATTAAAGG - Intronic
1115266118 14:31501977-31501999 CTGCAGTGTGAAGGCGTGAAGGG + Intronic
1115912467 14:38271557-38271579 CTTCCATGTAAACACTTTAATGG + Intergenic
1115972392 14:38960470-38960492 CTGACATCTGAAGATGCTAAAGG + Intergenic
1119373171 14:74165470-74165492 TTGCCATGGGAAGGAGTTAATGG + Intronic
1120892432 14:89503112-89503134 CAGCCATTTGAAGACGACAAAGG + Intronic
1121579547 14:95017491-95017513 CAGCCATGTGAAGACACAAATGG - Intergenic
1121659956 14:95627438-95627460 CTCCCATGGGAACACATTAATGG + Intergenic
1128375572 15:67072667-67072689 CAGCCATGTGCAGACGTGAATGG + Intronic
1130624466 15:85499600-85499622 CAGCCATGTGAAACTGTTAACGG + Intronic
1132146242 15:99431694-99431716 CAGCCATGTGAAGACCTGATAGG + Intergenic
1138782187 16:59802180-59802202 CAGCGATGTGAAGACCTGAATGG + Intergenic
1140492732 16:75353168-75353190 CTGCCATGTATAGACCTTACTGG + Intronic
1141094316 16:81152169-81152191 GTGCCATGTGTACAGGTTAATGG - Intergenic
1142347738 16:89564882-89564904 ATGCCATGTGGTGACGTGAATGG + Exonic
1143584834 17:7845909-7845931 CTGCCATGTGAAGGGGGTAGGGG - Exonic
1144261455 17:13526094-13526116 CTGCCCTGTGGAGACGCCAAGGG - Intronic
1148147986 17:45377977-45377999 CTGCCAGCTGAAGACGACAAGGG - Intergenic
1150219972 17:63490646-63490668 CTGACATGTGAGGACATTACAGG - Intronic
1151248756 17:72817249-72817271 CTGGCATGTGCAGAGGTCAATGG + Intronic
1156280711 18:35634821-35634843 CTGGCATGTGGAAACTTTAATGG - Intronic
1157517904 18:48324020-48324042 CCACCATGTGAAGACGGTACAGG + Intronic
1160067945 18:75594871-75594893 CTGCCTTGTGAAGAAGGTACTGG - Intergenic
1161408200 19:4102157-4102179 CTGCCAAGTGAAGACGTTATAGG - Intronic
1164526757 19:29018710-29018732 ATGCCATGTGAAGACGCAAGTGG + Intergenic
925473827 2:4191340-4191362 CTGCCATGTGAGGACAGTGAGGG + Intergenic
928885724 2:36146068-36146090 CTGCCATGTGAAGATGCAAAAGG - Intergenic
943077432 2:183212374-183212396 TTGCAATGGGAAGAAGTTAAAGG + Intergenic
946347097 2:219119416-219119438 CTGTCAAATCAAGACGTTAAGGG + Intronic
1172936732 20:38625780-38625802 CTGCCATGAGTAGACATTGATGG - Intronic
1178118599 21:29443624-29443646 TTGCCATGTGAAGAAGGTCATGG + Intronic
1184390007 22:44198088-44198110 CTGCCATTCGAAGCCCTTAATGG - Intronic
949134869 3:552337-552359 CTGCAATGTGAAGAAGGGAATGG - Intergenic
949724282 3:7025393-7025415 CTGCCATGTGAAGACGTTAAGGG + Intronic
952249219 3:31633152-31633174 GTGCCAAGTGAAGGCATTAAAGG + Intronic
952597618 3:35037572-35037594 CTGCCATGTGAGGAAGTAGAAGG - Intergenic
953133367 3:40161867-40161889 CAGCCATGTGAAGCCCTTAAAGG - Intronic
956327287 3:68068034-68068056 CTGCCATGTGAAGAACTGCAAGG - Intronic
959550803 3:107654842-107654864 CTGCCATGTAAAGTTGTTAGAGG + Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
971568493 4:28177909-28177931 CTGCCATGTGAGGATGCAAAGGG + Intergenic
976241441 4:82961409-82961431 CTGCCATGTGAAGAATTTCAGGG - Intronic
978625203 4:110677404-110677426 CTGCCATCTGAAGACACAAAAGG + Intergenic
979144250 4:117221069-117221091 CTGCCATGTGAAGAAGGAAGTGG + Intergenic
979294461 4:119014905-119014927 CAGTCATGTGAAGACATTATTGG + Intronic
979416310 4:120443893-120443915 TTGTCATGTGAAGAGGTAAAGGG - Intergenic
979493509 4:121357831-121357853 CTTCCAACTGAAGAGGTTAAGGG + Intronic
979579984 4:122346560-122346582 CTACCATGTGAAAACATTAAAGG + Intronic
983480595 4:168269278-168269300 CTGTGATGTGAAGAATTTAAGGG - Intronic
985835326 5:2267310-2267332 CTTACATATGAAGACATTAATGG + Intergenic
988209424 5:28184154-28184176 CTGCCATGTGAAGGCATAACCGG + Intergenic
996091704 5:119357664-119357686 CTGGCCTATGAAGAGGTTAATGG + Intronic
998986456 5:147763272-147763294 ATGCCATGTGAAGAACTGAAAGG - Intronic
1001764529 5:174234933-174234955 ATAAGATGTGAAGACGTTAAGGG + Intronic
1008810146 6:55486929-55486951 CTGCCATGTGAAGACATGGTAGG - Intronic
1009899284 6:69792240-69792262 CTGTCATGAGAAGACATTAAAGG - Intronic
1011258413 6:85447984-85448006 CTGCTGTGTGAAGAAGTCAAAGG + Intergenic
1017216109 6:151909509-151909531 CTGCCATCTGAAGACTTTCCTGG - Intronic
1019000618 6:168746836-168746858 CTGCCATGTTAAAACATTACAGG - Intergenic
1020768818 7:12360943-12360965 CTGCCATTTCAAAATGTTAAAGG + Intronic
1023545457 7:41313654-41313676 CTGTCCTGTGAAGACTTTATAGG + Intergenic
1030688464 7:112509533-112509555 CTGCCAGCTGAAGCCTTTAACGG + Intergenic
1033458119 7:141520767-141520789 CATCCATGTGAAAGCGTTAAGGG - Intergenic
1034941428 7:155232893-155232915 CTGCCCTGTGAAAGCGTTTAAGG - Intergenic
1041773694 8:61500187-61500209 CTGTCATGAGCTGACGTTAAAGG + Exonic
1042436371 8:68770637-68770659 CTGCCATGTGAAAAAGTGAGAGG - Intronic
1042579297 8:70258683-70258705 CTGGCATGAGAAGAAGTTATTGG - Intronic
1043164389 8:76885235-76885257 ATGTCATGTGAAGAAGTTTAAGG - Intergenic
1044851587 8:96433606-96433628 CTGCCATGTGAAGAAGGTCCTGG + Intergenic
1046226205 8:111284574-111284596 CTGCCATGTGAAGAAGGACATGG - Intergenic
1049165523 8:141123305-141123327 TTGCCATGTGTGGACGTTCAGGG + Intronic
1054740205 9:68798710-68798732 ATGCCATAAGAAGACATTAAAGG + Intronic
1055607032 9:77981427-77981449 AGGCCATGTGAAGACGCTGAAGG + Intronic
1059538630 9:115108826-115108848 CTGCCATGTGAGGACATATAAGG + Intronic
1189238821 X:39509687-39509709 CAGCCATGTGAAGAGGTCACAGG - Intergenic
1198644072 X:138787479-138787501 CTGCCATGTGAAGAGACAAAGGG - Intronic
1198699092 X:139377402-139377424 CTACCATATGAAGAAGCTAAAGG - Intergenic
1199083211 X:143599774-143599796 CTGCCCTGTGAATAGATTAATGG + Intergenic