ID: 949724532

View in Genome Browser
Species Human (GRCh38)
Location 3:7028129-7028151
Sequence CAGGCTAAGCACTGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949724532_949724537 -2 Left 949724532 3:7028129-7028151 CCAGTTTCCCAGTGCTTAGCCTG 0: 1
1: 0
2: 2
3: 20
4: 180
Right 949724537 3:7028150-7028172 TGGTGCAGAGCAACCCTAAGTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949724532 Original CRISPR CAGGCTAAGCACTGGGAAAC TGG (reversed) Intronic
900489121 1:2937604-2937626 CCGGCCAAACACTGGGAAACCGG - Intergenic
901790758 1:11652740-11652762 CAGGCCAGGCACTGGGGAAGGGG + Intronic
902200072 1:14826765-14826787 CAGGCTTACCAATGGGAAACAGG - Intronic
902625765 1:17675381-17675403 CTGGCTAAGCACGGGCAAATGGG + Intronic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
904032212 1:27540327-27540349 AAGGTTAAGCCCTGGGGAACGGG - Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
907038148 1:51235027-51235049 CACGCTAAGGACTGGGGAAAAGG - Intergenic
907395285 1:54185446-54185468 AGGGCGAAGCACTGGGAGACAGG + Intronic
907561821 1:55398003-55398025 CAGGCTGAACACAGGCAAACAGG + Intergenic
911691152 1:100836111-100836133 CTAGCGGAGCACTGGGAAACAGG + Intergenic
914984810 1:152447429-152447451 CATGCTAGGCACTGGGAGAAGGG + Intergenic
917314305 1:173708861-173708883 CAGGATTAGCACTGGGACCCCGG + Intergenic
919573188 1:199274213-199274235 GACTCTAAGCACTGGGAAACAGG + Intergenic
919932568 1:202230876-202230898 CAGGCCCAGATCTGGGAAACTGG + Intronic
920075161 1:203330777-203330799 CTGGCCCAGCACTGGGAAACCGG - Intergenic
922594968 1:226806575-226806597 CAGCCTCTGGACTGGGAAACTGG - Intergenic
923296676 1:232601142-232601164 CAGGCTGGGCCCTGGGACACAGG + Intergenic
923359024 1:233189212-233189234 CAGGTTCACCACTGGAAAACAGG + Intronic
923638888 1:235731375-235731397 CAGGCGAGGAACTGGGAGACTGG - Intronic
923771337 1:236940276-236940298 CAGGCTAAGCAGTGACAATCAGG + Intergenic
1065160907 10:22920487-22920509 TAGGGGAAGCACAGGGAAACAGG - Intergenic
1065323680 10:24532000-24532022 TAGGCTAAGCCCTGGTAAACTGG + Intronic
1066135425 10:32440972-32440994 CAGGCTGAGTACTGGAAAATAGG + Intergenic
1067488877 10:46679118-46679140 CAGACTAAGCATTGGAAAGCTGG - Intergenic
1067605791 10:47661258-47661280 CAGACTAAGCATTGGAAAGCTGG + Intergenic
1069162568 10:65109278-65109300 CAGGTAAATCAGTGGGAAACTGG + Intergenic
1071570300 10:86692955-86692977 AAGGCTGGGCACTGAGAAACAGG + Intronic
1073030069 10:100519196-100519218 CAGTCTAGGAACTGGGAAAATGG + Intronic
1076802081 10:132835497-132835519 CATGGTGAGCACTGGGAAAAGGG + Intronic
1078884876 11:15490140-15490162 AAGGCTCAGAACAGGGAAACTGG + Intergenic
1080194523 11:29593313-29593335 CTAAATAAGCACTGGGAAACAGG + Intergenic
1084147854 11:67274614-67274636 CAGGCTGTGCACTGGGAGACTGG - Intronic
1084461420 11:69298649-69298671 CAGGCAAAGCACTGGCAGAAAGG - Intronic
1086089963 11:82995760-82995782 CAGGCTAAGAACCTGGAACCCGG + Intronic
1089140924 11:116283289-116283311 CAGGCTGAGCACTGGCAACTTGG - Intergenic
1089401382 11:118166526-118166548 CAGGCCAAGCACTGGGCAGGTGG + Exonic
1090172370 11:124616287-124616309 CAGGCCAAGGAGTGGGAACCTGG - Intronic
1090404217 11:126467443-126467465 CAGGCTGAGCTCTCGGAAATGGG + Intronic
1090825884 11:130385645-130385667 CTGGCTAAGCACTGGAACACTGG + Intergenic
1091450340 12:568895-568917 CCGGGTAAGCACTGGGCCACAGG + Intronic
1092738272 12:11604708-11604730 CAGGCTAAGCAAAGGAAAAAAGG + Intergenic
1094376781 12:29798907-29798929 TAGTGTAAGCACTGGGAAAGTGG - Intergenic
1097393338 12:59042308-59042330 CAGGCTGGGCACTGGAAAAAGGG - Intergenic
1101583632 12:106066146-106066168 CTGGCTAGGCCCTGGGAATCGGG - Exonic
1102678431 12:114674097-114674119 CTGGCAAAGGACAGGGAAACTGG + Intronic
1102726873 12:115073478-115073500 CAGGCTGAGTAAGGGGAAACAGG + Intergenic
1104364360 12:128163693-128163715 GAGGCTAAGCACCTGGAATCAGG - Intergenic
1105003671 12:132707816-132707838 CAGGAGAATCACTTGGAAACGGG - Intergenic
1108934822 13:55870996-55871018 CTGGCTAAGCAATGGGTGACAGG - Intergenic
1109978364 13:69871944-69871966 CAGCCTTGGCACTGGGTAACGGG - Intronic
1110471522 13:75865179-75865201 CAGGTGAAGCATTGGGAACCTGG + Intergenic
1111442846 13:88303627-88303649 CAGGTTTGGAACTGGGAAACAGG + Intergenic
1113286283 13:108852382-108852404 CATGATAACCACTGGGGAACAGG - Intronic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1115484453 14:33896887-33896909 GAGGTTAAGCCATGGGAAACAGG + Intergenic
1116216552 14:42024501-42024523 CTGTCTATGAACTGGGAAACAGG - Intergenic
1118377053 14:65186660-65186682 TTTGCTAAGCACTGGGAAAATGG - Intergenic
1118607293 14:67513889-67513911 AAGGCCAAGCACTGGGGACCTGG + Intronic
1119148854 14:72340054-72340076 CATGCTAGGTGCTGGGAAACTGG - Intronic
1122916843 14:104863399-104863421 CAGGCAGAGCACTGGGCACCAGG + Intergenic
1125708797 15:41766708-41766730 CAGGTTGAGCACTTGGGAACTGG + Exonic
1126394135 15:48194511-48194533 GAAACTAAGCACTGGAAAACAGG - Intronic
1127804483 15:62506286-62506308 TAGGCTACCCTCTGGGAAACTGG + Intronic
1128619390 15:69136035-69136057 CAGTCTATGCACTAGGAGACTGG + Intergenic
1128676223 15:69610945-69610967 CAGGCAAAGCACTCTGAAATAGG - Intergenic
1128880901 15:71241996-71242018 CAGGCAAAGCAATGGGTAAATGG - Intronic
1135131391 16:19856417-19856439 CAGGCTTGTCATTGGGAAACCGG - Intronic
1135259424 16:20968023-20968045 AATGCTAAGCAATGGGAAGCAGG + Intronic
1136033913 16:27524135-27524157 CAGGCTATACAGTGGGAAGCGGG + Intronic
1136624427 16:31453326-31453348 CAGGCTCAGAGCTGGGAACCTGG + Intergenic
1137800966 16:51261908-51261930 CACACTAAGCACTGGGCAAATGG + Intergenic
1137858201 16:51818213-51818235 CATGCTAGGCACTGGGAATTAGG - Intergenic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1139061032 16:63251692-63251714 CAGGCAAAGCACTGGAAAACAGG + Intergenic
1139198247 16:64946340-64946362 CACACTGAGCACTGGGGAACTGG - Exonic
1141361051 16:83395396-83395418 CAGGATGACCACTGGCAAACAGG - Intronic
1141395205 16:83698472-83698494 GAGCCTCAGCACTGGGAACCAGG - Intronic
1141468254 16:84221392-84221414 AAGGCTAAGGACTGGATAACTGG + Exonic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1141945144 16:87304609-87304631 CAGGCCATGCACTGGGAAGGGGG - Intronic
1142644125 17:1301082-1301104 GAGGCTGCGCACTGGGAACCTGG + Intergenic
1143278201 17:5730444-5730466 CAGGCTTCTCACTGTGAAACTGG - Intergenic
1146604055 17:34242985-34243007 CAGGGCAAGGACTGGGAAACAGG - Intergenic
1152750656 17:82061016-82061038 CAGGCTGAGCACTGGGCACACGG + Intronic
1153074940 18:1151419-1151441 CAGGATAATCACTTGAAAACAGG - Intergenic
1156361041 18:36384867-36384889 CAGGCTAAGCCCTTGGCAAGTGG + Intronic
1156922148 18:42534889-42534911 AAGGCCTGGCACTGGGAAACAGG - Intergenic
1156972290 18:43170920-43170942 CAGCCTGAGCACTGGGAGAATGG + Intergenic
1157078716 18:44497916-44497938 CAGGCTAAGCTCTGGGAAGGAGG + Intergenic
1160668765 19:345885-345907 TTGGCTGATCACTGGGAAACAGG - Intergenic
1164465230 19:28482169-28482191 CAGGCTAAGGACTGAAAGACGGG + Intergenic
1164618151 19:29678790-29678812 CAGGCTCAGCTCTGGGGAAAGGG - Intergenic
1167466745 19:49654204-49654226 CACGCTCAGAACTGGGAAAAGGG - Intronic
1168244369 19:55103777-55103799 AGCGCTAAGCACTGGGAAAACGG + Intronic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926395660 2:12439868-12439890 CAGACAATGCACTGTGAAACAGG - Intergenic
927629998 2:24764855-24764877 CAGTCTAAGCATTAGGAAATAGG + Intronic
930852843 2:55979694-55979716 CAGGCTAAACAATGGTTAACAGG + Intergenic
944543516 2:200777077-200777099 CAGAGCAAGCACTGGGAAATGGG + Intergenic
946006097 2:216526207-216526229 CAGGCTAGGCACTGAGCAAGTGG + Intronic
946246549 2:218391137-218391159 CACGCTCAGCCTTGGGAAACTGG - Intronic
947342060 2:229150720-229150742 CAGTATAAGCACTGTGGAACGGG + Intronic
947814946 2:233030515-233030537 CAGCCTAAGGCCTAGGAAACCGG - Intergenic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1168752731 20:294670-294692 CAGGCTCAGCAATGGCAACCTGG + Intergenic
1172283378 20:33723745-33723767 CAAGCTATGAACTGGGAACCTGG + Intergenic
1173469362 20:43310755-43310777 CAGGCTAATTCCTGAGAAACAGG + Intergenic
1173906323 20:46632265-46632287 CAGGCTCAGTCCTGGGCAACGGG - Intronic
1173958062 20:47049965-47049987 CAAGCTAATCACCAGGAAACAGG - Intronic
1176028376 20:62997940-62997962 CAGGAGAAGCACGGGGAAGCCGG + Intergenic
1178476874 21:32944749-32944771 CAGGCTAAGCAGTGAGAACATGG + Intergenic
1181777193 22:25168305-25168327 CATGCTAGGCACCGGGGAACTGG - Intronic
1181888239 22:26038604-26038626 CACTTTAAGCGCTGGGAAACAGG + Intergenic
1182376193 22:29850048-29850070 CAAGCTAAGCACTGGGGATAAGG - Intergenic
1182979120 22:34651582-34651604 TACGGTAAGCACTGAGAAACAGG + Intergenic
1183843159 22:40517344-40517366 TAGGCTAAGTACTGGGAGAATGG + Intronic
1184129362 22:42508649-42508671 CAGCCTATGGACTGGGAAAGGGG + Intergenic
1184139561 22:42570742-42570764 CAGCCTATGGACTGGGAAAGGGG + Intronic
1184198011 22:42945133-42945155 CATGCTAAGCACTGGGGATACGG - Intronic
1184235653 22:43181736-43181758 CAGCCTAAGAACTGGAACACTGG - Intronic
949537122 3:5004800-5004822 CAGGCTCTGAGCTGGGAAACAGG + Intergenic
949724532 3:7028129-7028151 CAGGCTAAGCACTGGGAAACTGG - Intronic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950226123 3:11235849-11235871 CAGCCAAAGGACTGGGAAAGAGG - Intronic
953529354 3:43726162-43726184 CAGGTTAAAAACTAGGAAACAGG - Intronic
955973859 3:64462363-64462385 GATGCGAATCACTGGGAAACTGG - Intergenic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
960483914 3:118227727-118227749 CAGGTTCATAACTGGGAAACTGG - Intergenic
961324717 3:126103345-126103367 AAGGGTAACCCCTGGGAAACAGG - Intergenic
961620016 3:128216671-128216693 CAAGCAATTCACTGGGAAACAGG - Intronic
963025482 3:140914544-140914566 CTGGCTGAGCACTAGGGAACCGG - Intergenic
965493797 3:169372924-169372946 CATGCGGAGCAGTGGGAAACAGG - Intronic
967108064 3:186269816-186269838 CAGGCTAGGCACTTGGAAACAGG + Intronic
968927232 4:3556043-3556065 CAGGCTCAGAGCTGGGGAACCGG - Intergenic
968949024 4:3680788-3680810 CACGCTAATAACGGGGAAACTGG - Intergenic
969568899 4:7996396-7996418 CAGCCTGGGCACTGGGAACCTGG - Intronic
970058565 4:12003158-12003180 CAGTCTAGGAACTAGGAAACAGG + Intergenic
978555009 4:109970536-109970558 CAGGATAATCCATGGGAAACAGG + Intronic
981049793 4:140298545-140298567 CAGGCTAAGCTCTGGAAAGGAGG + Intronic
981169774 4:141607855-141607877 CAGGATAATCAATGTGAAACAGG - Intergenic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
985922505 5:2989708-2989730 CAGGAAAAGCACTTGGACACGGG - Intergenic
986096037 5:4554925-4554947 CAGTTTAGGCTCTGGGAAACAGG - Intergenic
989169083 5:38457488-38457510 CAGGGAAAGCCATGGGAAACTGG - Intronic
989187894 5:38642732-38642754 CAGAATAAGCCCTGGGAAGCAGG - Intergenic
990474229 5:56146054-56146076 GGGACTAAGAACTGGGAAACGGG - Intronic
991671357 5:69051330-69051352 CATCCTAAGAACTAGGAAACAGG + Intergenic
992184339 5:74229332-74229354 CAGGAGAAGCACTGAGAAACTGG - Intergenic
992695080 5:79278116-79278138 CAGGCTGAGAACTATGAAACAGG - Intronic
993478282 5:88391373-88391395 CAGGATTAGCACGGGGAATCAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
996757969 5:126954827-126954849 GAGGGTAGGCATTGGGAAACAGG - Intronic
997283035 5:132660464-132660486 CAGGCTGAGCCCTGGGCAAGGGG - Exonic
998065661 5:139156188-139156210 CCTGCTAAGCACTTGGAAATGGG - Intronic
998734046 5:145114577-145114599 CAGGAAAAGCACTGGAAAAGGGG + Intergenic
998812153 5:145977115-145977137 GAGGCCAAGCAAGGGGAAACTGG + Intronic
999896845 5:156043488-156043510 TTGGCTCAGCACTGGGAAAGTGG + Intronic
1000586959 5:163112249-163112271 CAGGCCCATCCCTGGGAAACAGG + Intergenic
1000958096 5:167565913-167565935 CAGACTAATCACTGGAAAAGTGG + Intronic
1000971231 5:167717055-167717077 GAGGCTGAGCACTTGGATACAGG - Intronic
1004759923 6:18655338-18655360 GAGGTTAAGCAATGAGAAACAGG - Intergenic
1005189010 6:23196775-23196797 GATGCTAAGCAATGGGACACAGG + Intergenic
1009684680 6:66941923-66941945 CAGGCTAAGCACTGGAACTATGG + Intergenic
1011195967 6:84779636-84779658 CAGGCTCAGCAATGGGAAATTGG - Intergenic
1013586309 6:111582121-111582143 GAGTCTAGGCACTGGGAACCTGG - Intronic
1014263065 6:119242078-119242100 CAGTCCAAGAACTAGGAAACAGG + Intronic
1016809283 6:148244166-148244188 CAGGCTTAGAGCTGGGAAAGGGG - Intergenic
1017505862 6:155068028-155068050 CAGGCTAAGAATTGGGAGAAGGG + Intronic
1017696008 6:157017042-157017064 CACACTAAGCAAAGGGAAACAGG - Intronic
1017905789 6:158756943-158756965 CAGGCAGAGCACTGGGCACCTGG + Intronic
1019774040 7:2901757-2901779 CACCCTAAGCTCTGGGAACCTGG - Intergenic
1021454906 7:20819257-20819279 CAGGATAAGCACTTGAACACAGG + Intergenic
1025617148 7:63130624-63130646 CAGGCTAAACACAGGGAATGAGG + Intergenic
1026122799 7:67552156-67552178 CAGGGTATGGACTGGGAATCTGG + Intergenic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1032628406 7:133619807-133619829 CAGCAGAAGCACTGGGGAACTGG - Intronic
1033232346 7:139610336-139610358 AAGGCGGAGCACTGGGAGACTGG + Intronic
1033393821 7:140954900-140954922 CATAAAAAGCACTGGGAAACAGG + Intergenic
1034352753 7:150428051-150428073 CAGGCCAAGCAGTGGCAAAGTGG + Intergenic
1034936352 7:155203162-155203184 CAGTCCAAGCACTGGAAAGCAGG - Intergenic
1040790833 8:51228023-51228045 CAGGGTAAGCAATGGCAAACGGG + Intergenic
1044296357 8:90531973-90531995 CAGGCAAAACACTAGGAAATGGG + Intergenic
1045784385 8:105903493-105903515 CAGGTTTAGAACTGGGTAACAGG - Intergenic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1048301760 8:133256532-133256554 CAGGGAAAGCACTGGGACACAGG - Intronic
1049474499 8:142790512-142790534 CAGGCTTGGCCCTGGGAAGCAGG - Intergenic
1053802157 9:41771453-41771475 CAGGCTCAGAGCTGGGGAACCGG - Intergenic
1054462824 9:65474717-65474739 CAGGCTCAGAGCTGGGGAACTGG + Intergenic
1054647929 9:67604978-67605000 CAGGCTCAGAGCTGGGGAACCGG + Intergenic
1056145363 9:83723659-83723681 CAGGCCAACTACTGGGAAATAGG - Intergenic
1057933700 9:99218807-99218829 CAGCCTGAACACTGGGATACAGG + Exonic
1059725183 9:117001533-117001555 CAGGCAGAGCACTGGGAGAGTGG - Intronic
1060462625 9:123871860-123871882 GATGCTTAGCACTGGGAGACTGG - Intronic
1060892599 9:127198282-127198304 AAGGCTGAGCACTGGGAAAGGGG - Intronic
1061758943 9:132836463-132836485 AAGGCAAATCTCTGGGAAACAGG + Intronic
1186499496 X:10039943-10039965 CAGGAAAAGCTCTGAGAAACAGG - Intronic
1189288444 X:39868308-39868330 CAGGCAAAGCCCTGGGAAGCTGG - Intergenic
1195319382 X:103709393-103709415 CAGGGTGAGTACTGGGCAACAGG - Intronic
1195599988 X:106735175-106735197 CATGCTGACCTCTGGGAAACTGG + Intronic
1199688761 X:150290289-150290311 TAGGCTATGGCCTGGGAAACAGG - Intergenic