ID: 949724652

View in Genome Browser
Species Human (GRCh38)
Location 3:7029577-7029599
Sequence CTGGCTTATTACCCTTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949724652_949724656 30 Left 949724652 3:7029577-7029599 CCTTGCAAAGGGTAATAAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 181
Right 949724656 3:7029630-7029652 CTTATATGTAATACCTAGAGTGG 0: 1
1: 2
2: 4
3: 43
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949724652 Original CRISPR CTGGCTTATTACCCTTTGCA AGG (reversed) Intronic
900925434 1:5703273-5703295 CTGGCTTATTTCACTTAGCACGG + Intergenic
901445823 1:9307516-9307538 CTGGCTAATTAAATTTTGCATGG + Intronic
901459717 1:9384317-9384339 CTGGCTTTCTGCCCTTGGCACGG - Intergenic
901562125 1:10080783-10080805 CTGGCTTATTTCACTTAGCATGG - Intronic
903641699 1:24864511-24864533 CTGGCTTTTTCCCCTGTGCTTGG + Intergenic
905946592 1:41906410-41906432 CTGGCTTCTTTCTCTTAGCATGG - Intronic
906111758 1:43328475-43328497 CTGGCTTCTTTCACTTAGCATGG - Intergenic
906374270 1:45281966-45281988 CTGGCTTATTATCACTTCCAGGG - Intronic
906462950 1:46050918-46050940 CTGGCTTCTTTCACTTAGCATGG - Intronic
906623852 1:47308485-47308507 CTGGCTTATTTCACTTAACATGG - Intronic
908257451 1:62314668-62314690 GTGGCTTTTCCCCCTTTGCATGG - Intronic
908533425 1:65055270-65055292 CTGGCTTATTTCACTTAGCATGG + Intergenic
910346049 1:86239858-86239880 CTAGCATAGTACCATTTGCATGG - Intergenic
912327030 1:108775674-108775696 CTGGCTTATTTCGCTTAACATGG + Intronic
913462345 1:119100930-119100952 CTGGCTTATTTCACTTGCCAGGG - Intronic
918933232 1:190884700-190884722 CTGGCTTATTTCCTTTAACATGG - Intergenic
919923119 1:202177974-202177996 CTGGCTGATATCCCTTTCCATGG + Intergenic
920702915 1:208231308-208231330 CTGGCTGTTTACCCTTTTCCCGG - Intronic
921342820 1:214151655-214151677 CTGGCTTGTTTCACTTAGCATGG - Intergenic
921895825 1:220399502-220399524 CTGGCTTTGTTCCTTTTGCAAGG + Intergenic
1064578302 10:16768249-16768271 CTGGATTATGACCATTTCCAAGG + Intronic
1065044707 10:21736912-21736934 CTGGCTTATTCTCCTTTTCTAGG - Intronic
1066357049 10:34695052-34695074 CTGGTTAAATACCCTGTGCAGGG + Intronic
1067011970 10:42722623-42722645 CTGGATTATGACCGTTTCCAAGG - Intergenic
1067028077 10:42860852-42860874 CTGGCATTTTAACATTTGCAGGG + Intergenic
1067311621 10:45119235-45119257 CTGGATTATGACCATTTCCAAGG + Intergenic
1068478465 10:57559014-57559036 CTGGCTTATTTCACTTAACATGG + Intergenic
1072792238 10:98326796-98326818 CTGGTTTATTGCCCCTTGCCTGG - Intergenic
1073372809 10:103006128-103006150 TTGTCTTATTTCCCATTGCAGGG + Intronic
1074857866 10:117486678-117486700 CTAATTTATTAGCCTTTGCATGG + Intergenic
1076589879 10:131575567-131575589 CTGGCTTATTTCACTTAGCACGG - Intergenic
1076658669 10:132040950-132040972 CTGGCTTATTTCACTTAGCATGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079849577 11:25514634-25514656 CTGGCTTGTTACAGATTGCACGG - Intergenic
1079885243 11:25980242-25980264 ATGGCTTACTACACTTTACACGG - Intergenic
1085841942 11:80022014-80022036 CTGGCTTATTTCACTTAGCCAGG + Intergenic
1087977825 11:104571851-104571873 TTGGCTTATTTCACTTAGCATGG - Intergenic
1092871143 12:12807015-12807037 CTGACTGATTACATTTTGCATGG + Intronic
1093115167 12:15200589-15200611 CTGGCATTTTGCCCTTTGTAGGG + Intronic
1096290845 12:50341875-50341897 CTGGCTTAGTACTTTTTGAAGGG - Intronic
1097258928 12:57702350-57702372 CTGGCTTATTTCACTTAGCATGG + Intronic
1097562856 12:61230060-61230082 CTGGCTTATTAAGCTCAGCATGG + Intergenic
1097635215 12:62113969-62113991 CTGGCTTACGCCCCTTTCCAAGG + Intronic
1098018075 12:66127385-66127407 CTGGCTTATTTCCCTTAGCATGG - Intronic
1098306400 12:69107035-69107057 CTGGCTTATTATCAGTTTCATGG - Intergenic
1099856299 12:88171471-88171493 CTGGCTTATTTCTCTTAACATGG + Intronic
1101327605 12:103729785-103729807 CTGGCTTTTTTCCTTCTGCAAGG - Intronic
1101349516 12:103915859-103915881 CTGGCTCATTTCTCTTTGCTTGG + Intergenic
1102105446 12:110317747-110317769 ATGGCTTATAAACGTTTGCATGG + Intronic
1102150187 12:110683993-110684015 CTGGCTTTTTTCACTTAGCATGG - Intronic
1104302709 12:127580000-127580022 CTTTCTTATTTCTCTTTGCATGG + Intergenic
1104406620 12:128523130-128523152 CTGTCTTATTTCACTTAGCACGG - Intronic
1106072476 13:26425892-26425914 CTGTGTGATTACCCTTTGGACGG - Intergenic
1107288022 13:38818406-38818428 CTGGCTTATTTCACTTAACATGG - Intronic
1107794201 13:44033195-44033217 CTGGCTTATTTCTTTTTGGATGG - Intergenic
1109664249 13:65509837-65509859 CTGGTTTATTTCACTTAGCAAGG + Intergenic
1110507836 13:76309614-76309636 CTGGCTTATTTTACTTAGCAGGG - Intergenic
1111593356 13:90378627-90378649 CTGTCTTCTTGCCCTTTGAAAGG - Intergenic
1113486691 13:110658247-110658269 CTGGCTTATTTCACTTAGCATGG - Intronic
1116115462 14:40643869-40643891 CTGGCTTGTTTCACTTAGCATGG + Intergenic
1116231096 14:42217838-42217860 CTGGCTTAATACCCATGTCAGGG - Intergenic
1118231407 14:63953856-63953878 CTGGCTTATTTCACTTGGCATGG + Intronic
1120393199 14:83934635-83934657 TTGGCTTATTTCTCTTTGCATGG + Intergenic
1120995831 14:90418143-90418165 CTGGCTTTTTTCACTTAGCATGG + Intergenic
1121851404 14:97224304-97224326 CTGGCTTATTCCCATTCGTATGG + Intergenic
1124339631 15:28881924-28881946 CTGGTTTTTAACCCTTTGGAGGG - Intergenic
1124348604 15:28939126-28939148 CTGTCTTATTTCACTTCGCATGG + Intronic
1125596996 15:40893783-40893805 CTGGCTTACGACCTTTTCCAGGG + Intergenic
1126563960 15:50075472-50075494 CTGGGTTTCTACCATTTGCAGGG + Intronic
1128977122 15:72162148-72162170 CTGGCTTCTGACCCTAAGCAAGG - Intronic
1131283882 15:91041868-91041890 CTGGCTTATTTCACTTAACATGG + Intergenic
1132575970 16:664323-664345 CTGGCTTCTCACCCTGAGCATGG + Intronic
1133521688 16:6564520-6564542 CTGGCTTATCTCACTTAGCACGG - Intronic
1134891311 16:17843977-17843999 CTGGATAATTACCTGTTGCAGGG + Intergenic
1135514808 16:23122673-23122695 CTGGCTTCTTTCACTTAGCATGG - Intronic
1137372816 16:47924182-47924204 CTGGCTTCTCATCCTTTGAAGGG + Intergenic
1137967326 16:52949009-52949031 CTGGCTTATTTCACTTAACAAGG - Intergenic
1138202311 16:55099270-55099292 CTGACTTTTTACCCTTTGCTGGG + Intergenic
1141458885 16:84164535-84164557 CTGGCTTCTTTCACTTAGCAAGG + Intronic
1142653573 17:1373930-1373952 CTGGCTTCTTTCCCATAGCATGG + Intronic
1142824926 17:2504091-2504113 GTGGTTTATTTCCCTTAGCATGG - Intronic
1143468187 17:7152642-7152664 CTGGATAATTTTCCTTTGCATGG - Intergenic
1143930330 17:10416223-10416245 CTGGCTTATTTCACTCAGCATGG + Intronic
1148111282 17:45145842-45145864 CTGGGTTCTAACCCTTTGCCAGG - Intergenic
1152735523 17:81995262-81995284 CTGGCTGAGTGCCCTTTGCTGGG + Intronic
1155140936 18:23043904-23043926 CTGGTTTATTTCACTTAGCATGG - Intergenic
1157095536 18:44682626-44682648 CTGTCTTAATACCCTTTTCTGGG - Intronic
1158512545 18:58104184-58104206 CTGGCTTCTTTCACTTAGCATGG - Intronic
1161423174 19:4186870-4186892 CTGGCTGATTCCCCTGTGCCTGG - Intronic
1164458165 19:28426477-28426499 CTGGCTTCTTCCAGTTTGCAGGG - Intergenic
1164726177 19:30467384-30467406 CTGGCTTATTTTGCTTAGCATGG + Intronic
1167825436 19:51968661-51968683 CTGGCTTGATACCCTGTTCATGG + Exonic
1167828928 19:52001896-52001918 CTGGCTTGATACCCTGTTCATGG + Exonic
926225325 2:10962897-10962919 CTGGCTTCTTTCACTTAGCATGG + Intergenic
928507987 2:31973689-31973711 CTGGCTTCTTTCACTTAGCATGG - Intronic
929480170 2:42298898-42298920 TAGGCTTATTTCCCTGTGCATGG - Intronic
929491843 2:42404092-42404114 CAGGCCTAGTAACCTTTGCATGG + Intronic
929621072 2:43354625-43354647 CTGGCTTATTTCACTTAACATGG + Intronic
929643793 2:43607635-43607657 ATGGCTTATTGCCCTCTGCATGG - Intergenic
929994201 2:46815118-46815140 CTGGCTTTCTTCCCTTTGCCTGG - Intergenic
933181126 2:79229198-79229220 CTGGCTTTTTACTTTTTGCTTGG + Intronic
935930821 2:108122687-108122709 CTGACTTATTTCCCTGTGTATGG - Intergenic
936598936 2:113876720-113876742 CTTGCTGACTACCCTTTGCCTGG - Intergenic
936738843 2:115479283-115479305 CTAGCTTATTTCCCTTAGCATGG - Intronic
937226068 2:120369603-120369625 CTGGCTTCTTTCACTTGGCATGG + Intergenic
937812665 2:126216466-126216488 CTGGCTTATATCTCTTTCCAGGG - Intergenic
937936122 2:127247014-127247036 CTGCCACATTACCCTTTACAGGG - Intergenic
939987073 2:148840166-148840188 CTGTTTTTTTCCCCTTTGCATGG + Intergenic
940759756 2:157724808-157724830 CTGGCTTATTTCGGTTAGCATGG - Intergenic
941126300 2:161587903-161587925 CTGGCTTATTTCTCTTAGCATGG + Intronic
941235274 2:162964020-162964042 TTGCCTTATAACCATTTGCAAGG + Intergenic
941333578 2:164211084-164211106 CTGGCTGTGTACCCTCTGCATGG - Intergenic
942327254 2:174786538-174786560 CTGGCTTATTTCCCTTGGCACGG - Intergenic
942857811 2:180571914-180571936 CTGGCTTCTTTCACTTAGCATGG - Intergenic
944159904 2:196648023-196648045 CTGGCTTATTTCCCTATTGATGG + Intronic
944442943 2:199761135-199761157 CAGGCTTCTTACTCTGTGCAGGG - Intronic
944546376 2:200802986-200803008 CTGGCTTATTTCATTTAGCAAGG - Intergenic
947940606 2:234051692-234051714 CTGCCTTATTATCATCTGCATGG + Intronic
1171026819 20:21638390-21638412 CTGGCTTATTTCACTTAGCGTGG + Intergenic
1172898871 20:38319751-38319773 CTGGCTTCTGAGCCTCTGCATGG + Intronic
1174727955 20:52884145-52884167 TTTTCTTATTACCATTTGCATGG + Intergenic
1174953489 20:55068626-55068648 CTTGCTTCCTACCCTTTGCTAGG + Intergenic
1176410069 21:6444832-6444854 CTAACTTATTTCACTTTGCATGG - Intergenic
1179685562 21:43053154-43053176 CTAACTTATTTCACTTTGCATGG - Intergenic
1181266723 22:21634998-21635020 CTGGCTGACCACGCTTTGCAGGG - Exonic
1181328190 22:22067560-22067582 TTGGCTCATTACCCTTTGCAAGG + Intergenic
1183286013 22:36964490-36964512 CTGGCTTATTCCCCTCCACATGG - Intergenic
1184044397 22:41963675-41963697 CAGCCTTCTTTCCCTTTGCAGGG - Intergenic
949724652 3:7029577-7029599 CTGGCTTATTACCCTTTGCAAGG - Intronic
953536315 3:43779522-43779544 ATGGCTTGTTGCCCTTTTCATGG + Intergenic
956921478 3:73934473-73934495 TTGGCTTGTTAAGCTTTGCAAGG - Intergenic
959270821 3:104207615-104207637 ATGACTTTTTACCCTTGGCATGG + Intergenic
959729087 3:109580443-109580465 TTGACTTGTTCCCCTTTGCATGG + Intergenic
959818149 3:110700791-110700813 CTGGCTTATTTCACTTAACATGG + Intergenic
961380797 3:126495417-126495439 CTGGGTTATTTCACTTAGCATGG + Intronic
961756255 3:129128810-129128832 CTGGCTTCCTGCCCTCTGCAGGG - Intronic
961967180 3:130917910-130917932 CTGGCTTATTTCACTTAGCATGG + Intronic
965025481 3:163296929-163296951 CTGGCTTTACACCCTTTTCAGGG - Intergenic
965050259 3:163637726-163637748 CTGGCTTATTTCACTTAGCATGG - Intergenic
966600244 3:181767701-181767723 TTGGCTTTTTACTCTTAGCAAGG - Intergenic
967042370 3:185705393-185705415 CTGGCTCAAAACCCTTTGCAGGG - Intronic
970395188 4:15658117-15658139 CTGGCCAATAACCCTTTCCAGGG - Intronic
971065905 4:23032992-23033014 CTGGCAAATAACCATTTGCAGGG - Intergenic
974351849 4:60758452-60758474 CAGGCTTCTTCCCCTTTGCAGGG - Intergenic
976429787 4:84949002-84949024 CTGGCTGTTTACCCCTGGCACGG + Intronic
977349943 4:95870457-95870479 GTGCCTTATCACCCTTTGAAAGG + Intergenic
979318452 4:119296040-119296062 CTGGCTTGTTAGCAGTTGCAAGG - Intergenic
980200579 4:129651713-129651735 CTGGCTTCTACCCCTTTCCAGGG - Intergenic
980560507 4:134466987-134467009 CTTGATTATTAGACTTTGCATGG - Intergenic
982639539 4:157940950-157940972 CTGGCTTATTTCACTTGGTATGG - Intergenic
983309899 4:166046260-166046282 CAGGCTTGTTTCCCTCTGCATGG - Intronic
987769698 5:22284865-22284887 CTGGCTTCTTTCCCTTTTCCTGG - Intronic
989441672 5:41479205-41479227 CTGGCTTATTTCACTTTGCATGG - Intronic
990102224 5:52205046-52205068 TTGGCTTATTAAACTTTGCAAGG - Intergenic
990758515 5:59102608-59102630 CAGGCTTTTTCCCCTTTGAAGGG - Intronic
993392952 5:87343940-87343962 CTGGCTTATTTCACTTAACATGG - Intronic
993952458 5:94193739-94193761 CTAGCTTCATAACCTTTGCAAGG - Intronic
998137374 5:139681241-139681263 CTGGCTGAGTACCCCATGCAGGG + Exonic
1000184084 5:158842096-158842118 CTGGCTGATTGTCCTGTGCAAGG - Intronic
1001346406 5:170903461-170903483 CTGGCTTAGCCCCCTTTCCAGGG + Intronic
1001388257 5:171357746-171357768 CTGGTTTCTGAACCTTTGCAGGG - Intergenic
1003619029 6:7681066-7681088 CTGGCTGATTGCCCATTGCTGGG + Intergenic
1004146736 6:13074513-13074535 CTGTCTTACTATCCTTTGCCAGG - Intronic
1005054623 6:21717857-21717879 GAGGGTTATTTCCCTTTGCAAGG + Intergenic
1005171254 6:22987812-22987834 ATGGGTTATTGTCCTTTGCAGGG - Intergenic
1008894229 6:56534132-56534154 CTGGCTTATTTCACTTAGCATGG - Intronic
1010500129 6:76588519-76588541 ATGGTTTACTTCCCTTTGCATGG + Intergenic
1011764572 6:90606289-90606311 CTGGCTCATTATCCTTTGTTGGG + Intergenic
1012542077 6:100372784-100372806 CAAGCTTCTCACCCTTTGCATGG - Intergenic
1012771257 6:103437652-103437674 GTGGCTTTTTCCCCTTTGCTTGG - Intergenic
1014902378 6:126983828-126983850 CTGGCTTCACACCCTTTCCAGGG - Intergenic
1019149694 6:169997064-169997086 CTGGCTTATTCCACTGAGCATGG - Intergenic
1019303322 7:320476-320498 CTGGCTTCTTTCCCTGAGCAGGG - Intergenic
1019609869 7:1930948-1930970 CTGCCATCTCACCCTTTGCAGGG + Intronic
1021294814 7:18891601-18891623 CTGGCTTCTTAGTCTTTCCAGGG + Intronic
1023149438 7:37187181-37187203 CTGGCTTCTTTCACTTAGCATGG - Intronic
1025880953 7:65536082-65536104 CTGGCTTATTTCACTTTACATGG - Intergenic
1026679621 7:72455765-72455787 TTGGCTTATTCCCCCTTGCTTGG - Intergenic
1028781397 7:94741161-94741183 CTGGCTTATTTCGCTTAGCCTGG - Intergenic
1030947536 7:115742415-115742437 CTGGCTTCTTTCACTTAGCATGG - Intergenic
1032135851 7:129276832-129276854 CTTGCTGATTAATCTTTGCAGGG - Intronic
1033067535 7:138170527-138170549 CTGGCTTATTCACATCTGCAGGG - Intergenic
1035818236 8:2563145-2563167 CTGGCTTATTTCACTTAGCATGG + Intergenic
1039625205 8:39043028-39043050 CTGCCTTATTTCTCTTAGCATGG + Intronic
1040735142 8:50497010-50497032 CAGGCTTATTAATCTTTTCAGGG - Intronic
1041262405 8:56033192-56033214 CTGGCTTATTTCACTTAACATGG - Intergenic
1042230564 8:66550125-66550147 CTGGCTTATTTCACTTAGCAAGG - Intergenic
1043785897 8:84399722-84399744 ATGTCTTATAACCCTTTCCATGG + Intronic
1047543167 8:125790322-125790344 CTGTCTTATTACCCTTGGCCAGG + Intergenic
1049201414 8:141342323-141342345 CTGGCTTCTTTCACTTAGCACGG + Intergenic
1049984592 9:937114-937136 CTGGCTTATTTCACTAAGCACGG + Intronic
1049987755 9:968177-968199 CAGGCTTATTCCACTTTCCATGG + Exonic
1051695182 9:19760677-19760699 CTGACTTAATGTCCTTTGCAGGG - Intronic
1052321932 9:27176955-27176977 CTGGCTTATTTCACTTAGCATGG + Intronic
1052642191 9:31182552-31182574 CTGGCTTATTTCACCTAGCATGG - Intergenic
1052891573 9:33705060-33705082 CTGGCTTAGGACGCTTTTCAAGG + Intergenic
1054800947 9:69347522-69347544 CAGGCTTATTACTCTAGGCAGGG - Intronic
1059649484 9:116302495-116302517 CTGGATTATTTCCCTTAACATGG + Intronic
1060572605 9:124656453-124656475 CAGGCTTATTTCACTTAGCATGG - Intronic
1062484460 9:136768148-136768170 CTGGCTTCTGTCCCTCTGCAGGG - Intergenic
1189081166 X:37973925-37973947 TTGGCTTATTTCACTTAGCATGG - Intronic
1189327064 X:40119170-40119192 CTGGCTTCTTTTCATTTGCAAGG - Intronic
1193920676 X:87421956-87421978 CTGGGTTATTTCACTTGGCATGG + Intergenic
1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG + Intergenic
1196267987 X:113675339-113675361 CTGGCTTCCTTCCCTTTCCATGG - Intergenic
1198207862 X:134485383-134485405 CTGGGTTTTTACCCTTTCTACGG + Intronic
1199179372 X:144835637-144835659 CTGGCTTATTTCACTTAACATGG - Intergenic
1199657192 X:150007751-150007773 CTGGCTTTGCACCCTTTGCCTGG - Intergenic
1200885185 Y:8260566-8260588 CTCACTTATTACCCATGGCAAGG + Intergenic
1202108121 Y:21391515-21391537 CTCACTTATTAACCATTGCAAGG + Intergenic