ID: 949725643

View in Genome Browser
Species Human (GRCh38)
Location 3:7041268-7041290
Sequence CAGGAGAATTAGAGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 569}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949725643_949725648 3 Left 949725643 3:7041268-7041290 CCTGTCTCCCTCTAATTCTCCTG 0: 1
1: 0
2: 3
3: 34
4: 569
Right 949725648 3:7041294-7041316 CCTTCCACCTTCCCATTCCCAGG 0: 1
1: 0
2: 4
3: 56
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949725643 Original CRISPR CAGGAGAATTAGAGGGAGAC AGG (reversed) Intronic
900169843 1:1261512-1261534 CTGGTGAAGTTGAGGGAGACTGG + Intronic
900960458 1:5915768-5915790 CTGGAGAATTAGTGGGACAGTGG - Intronic
901780029 1:11587859-11587881 CAGGAGGAAGAGAGAGAGACAGG - Intergenic
902018442 1:13327509-13327531 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018448 1:13327528-13327550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018454 1:13327547-13327569 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018460 1:13327566-13327588 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018466 1:13327585-13327607 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018472 1:13327604-13327626 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018478 1:13327623-13327645 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018484 1:13327642-13327664 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902200969 1:14833398-14833420 CAGCAGAATGGGAGTGAGACAGG + Intronic
902441816 1:16435407-16435429 CAGGAGAATTGCATGGACACGGG - Intronic
903196146 1:21689785-21689807 CAGGAGACTTAGAGGAGGTCAGG - Intronic
903307430 1:22423087-22423109 CAGGAGAATTGCTTGGAGACAGG + Intergenic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903638152 1:24834812-24834834 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638158 1:24834831-24834853 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638164 1:24834850-24834872 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638174 1:24834882-24834904 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638192 1:24834939-24834961 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638202 1:24834971-24834993 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
903921800 1:26804847-26804869 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
903921806 1:26804866-26804888 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
903921812 1:26804885-26804907 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
904056217 1:27672045-27672067 CATGAGATTTACAGGCAGACAGG + Intronic
904879028 1:33680608-33680630 CAGGAGACTGAGAGGCTGACCGG - Intronic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
904939815 1:34157716-34157738 CAGGATAGATAGAGTGAGACAGG - Intronic
907425371 1:54375980-54376002 TAGGAGAGGTAGAGGGATACAGG + Intronic
908269699 1:62410985-62411007 CTGGAGAATAAGAGTCAGACAGG - Intergenic
908386431 1:63646655-63646677 CAGGAGAATAAAAGGGAAACGGG - Intronic
908903666 1:68984216-68984238 AAGGAGAAATAGAGGAAGAAAGG - Intergenic
910120211 1:83779841-83779863 CAAGAGAGGGAGAGGGAGACAGG + Intergenic
910744483 1:90558464-90558486 CTGGAGCATTAGATGGGGACTGG - Intergenic
910834551 1:91495236-91495258 CAGGAGAATGGGAGGGTGAGAGG - Intergenic
911302647 1:96193518-96193540 CAGGAGATTTAGGAGGGGACAGG + Intergenic
915312761 1:155012531-155012553 CAGGAGGATTAAAGGGAGCAGGG + Intronic
915444782 1:155968432-155968454 CAGGAGGAATTGAGGGAGAGGGG + Intronic
915467172 1:156104530-156104552 AAGGAGAGTAAAAGGGAGACAGG - Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915659419 1:157389831-157389853 CAGCAGAATTAGAAGGATCCAGG + Intergenic
915841155 1:159214397-159214419 CCAGAGAATTAGAGGGATGCAGG + Intergenic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
917082140 1:171267166-171267188 AAGGTGAATTAGAGGGAGCTGGG - Intronic
917417516 1:174826047-174826069 CAGGACTATTTGAGGGAGGCAGG - Intronic
918045668 1:180939546-180939568 CAGGAGAAGTGGTGGGAGGCAGG - Intronic
918474198 1:184905587-184905609 CAGGGGACTTAGGGGGAGAAAGG - Intronic
918487286 1:185043492-185043514 CAGGAGAATTAGTGGAAAAACGG - Intergenic
919566256 1:199192680-199192702 TAGGAAAATTAGTGGGAGAGGGG + Intergenic
919617979 1:199831278-199831300 CAGGAGAATTACATGAAGCCAGG + Intergenic
919918917 1:202156743-202156765 CAGGAGGGTTAGCAGGAGACAGG + Intronic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921554716 1:216584100-216584122 AAGGAGAATGAGAGGAAGAATGG - Intronic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922926072 1:229347642-229347664 CAGGAGAACCACAGGGGGACAGG - Intergenic
923511419 1:234656968-234656990 CAGTAGACTTAGAGGTAGCCCGG + Intergenic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
1062795340 10:341047-341069 CAGGAGAAGTAGAGGGACACGGG + Intronic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1065840140 10:29695785-29695807 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840150 10:29695817-29695839 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840164 10:29695861-29695883 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840170 10:29695880-29695902 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840176 10:29695899-29695921 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840194 10:29695955-29695977 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1066068594 10:31781198-31781220 CAGGTGAATTGAAGGGAAACAGG + Intergenic
1066085114 10:31968974-31968996 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085120 10:31968993-31969015 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085126 10:31969012-31969034 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085132 10:31969031-31969053 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085138 10:31969050-31969072 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085144 10:31969069-31969091 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085150 10:31969088-31969110 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1067530681 10:47069395-47069417 AAGGAGAGGCAGAGGGAGACAGG - Intergenic
1067975859 10:51024750-51024772 CAGGAGGAAGAGAGGGAAACGGG + Intronic
1068316281 10:55347187-55347209 CCTGGGAAATAGAGGGAGACTGG + Intronic
1069063880 10:63922495-63922517 AAGGAGAGAGAGAGGGAGACAGG + Intergenic
1069796785 10:71058519-71058541 CAGGAGCATTAGGGGGAGCTGGG + Intergenic
1070128701 10:73641757-73641779 CTGAAGACTGAGAGGGAGACAGG + Exonic
1070370830 10:75780353-75780375 CAGGAGAAGGAGAGTGAAACAGG + Intronic
1070947003 10:80400669-80400691 CAAGATGCTTAGAGGGAGACTGG + Intergenic
1071431882 10:85612928-85612950 CAGGAGGAATATAGGGAGAAAGG + Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072999452 10:100276314-100276336 CGGGAGAGAGAGAGGGAGACGGG - Intronic
1072999472 10:100276385-100276407 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999478 10:100276404-100276426 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999484 10:100276423-100276445 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999490 10:100276442-100276464 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999496 10:100276461-100276483 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999510 10:100276505-100276527 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1073027291 10:100497319-100497341 CAGGAGAAGGAGAGGCACACAGG - Intronic
1073911083 10:108345534-108345556 TAGGTGAATTGGAGGGAGAGGGG - Intergenic
1073969460 10:109030888-109030910 CAGGAGTGTTTGATGGAGACGGG + Intergenic
1074148837 10:110740488-110740510 CAGGAGAGCTAGTGGGAGCCAGG + Intronic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1075672674 10:124273162-124273184 CAGGAGAATGGGAAGGAGAGAGG - Intergenic
1076160432 10:128240155-128240177 CAGGAGCACTAGAGAGAAACAGG + Intergenic
1076304856 10:129458806-129458828 AAGGACAAAGAGAGGGAGACAGG - Intergenic
1076631288 10:131853576-131853598 CAGGAGAAATGGAGGGAGAGGGG - Intergenic
1076768524 10:132650796-132650818 CATGAAAATAAGAGGGAGTCCGG + Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1078677730 11:13440079-13440101 CAGGTGAGGTAGGGGGAGACTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079633842 11:22711476-22711498 GAGCAGAATCAGGGGGAGACGGG + Intronic
1080461924 11:32462248-32462270 CAGGAGAGTTAGAAGGGGAGTGG + Intergenic
1080615837 11:33944029-33944051 AAGGAGACTGAGATGGAGACAGG - Intergenic
1081642216 11:44764038-44764060 CAGGAGAAAGAGAGAGAGAGGGG + Intronic
1081777935 11:45689018-45689040 CAGGAGACTAAGAGTGAGCCAGG + Intergenic
1083865269 11:65450348-65450370 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1083865275 11:65450367-65450389 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1084661110 11:70546898-70546920 CAGGAGAAGTCCAGGGAGTCTGG - Intronic
1084897426 11:72283828-72283850 CAGGACAATTAGAGAAAGGCTGG + Intergenic
1085116892 11:73937665-73937687 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
1085116908 11:73937715-73937737 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1085558116 11:77444222-77444244 TAGGAGAATAAGAAGGAAACTGG - Intronic
1085754223 11:79190845-79190867 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754229 11:79190864-79190886 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754235 11:79190883-79190905 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754241 11:79190902-79190924 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754247 11:79190921-79190943 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754253 11:79190940-79190962 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754261 11:79190966-79190988 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754267 11:79190985-79191007 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754273 11:79191004-79191026 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754279 11:79191023-79191045 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754285 11:79191042-79191064 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754291 11:79191061-79191083 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754313 11:79191130-79191152 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1088412240 11:109547352-109547374 CATAAGAAAGAGAGGGAGACAGG - Intergenic
1088587900 11:111376308-111376330 CAGGAACCTTGGAGGGAGACAGG - Intronic
1088991836 11:114960712-114960734 CAGGAGAAATTGAGTGAGACTGG - Intergenic
1089128540 11:116194130-116194152 GAAGAGCATTAGAGGGAGAGAGG + Intergenic
1089567450 11:119379211-119379233 CAGGAGAATTAAAGGGGCAGTGG + Intronic
1090780760 11:130003969-130003991 CCTGAGAAAAAGAGGGAGACAGG + Intergenic
1090861124 11:130653482-130653504 CAGAAGAAGTAGAGAGAAACTGG + Intergenic
1091184662 11:133636808-133636830 CGGGAGAATTAACAGGAGACAGG + Intergenic
1091378387 12:41224-41246 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378393 12:41243-41265 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378399 12:41262-41284 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1092165350 12:6339059-6339081 TGGGAGAATTAGAGGGAGTGGGG - Intronic
1093198502 12:16157969-16157991 CAGGATAATAAGAGCCAGACAGG - Intergenic
1093987394 12:25551598-25551620 CAGGAGTATTAGAGACAGCCCGG - Intronic
1096750905 12:53758259-53758281 GAGGAGAAATAGAGGAAGGCAGG - Intergenic
1097469891 12:59976380-59976402 CAGGAGAATGAAATAGAGACAGG - Intergenic
1099259543 12:80360478-80360500 AAGGAGAGTGAGAGGGAGAGAGG - Intronic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100199098 12:92279337-92279359 CAGGAGGATCAGAGGGAATCAGG + Intergenic
1100569812 12:95837200-95837222 CAGGAGAGAGAGAGGGAGAGAGG + Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100570936 12:95842386-95842408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570942 12:95842405-95842427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570948 12:95842424-95842446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570954 12:95842443-95842465 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570960 12:95842462-95842484 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570966 12:95842481-95842503 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570972 12:95842500-95842522 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570978 12:95842519-95842541 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1101846753 12:108369055-108369077 CTGGAGACTTGGAGGGAGAGGGG - Intergenic
1104650248 12:130525999-130526021 CAGGAGAATAAGAGGCAAATTGG - Intronic
1105703397 13:22950793-22950815 GAGGAGAAATAGAAGGAGACAGG + Intergenic
1105856039 13:24372941-24372963 GAGGAGAAATAGAAGAAGACAGG + Intergenic
1106606315 13:31232411-31232433 CAGGAGGGTTAGAGAGAGAGGGG + Intronic
1106679972 13:31999475-31999497 CTGGAGAGGGAGAGGGAGACGGG - Intergenic
1106845444 13:33733120-33733142 CAGGTGAAACAGAGGTAGACAGG + Intergenic
1107562521 13:41571325-41571347 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1108971301 13:56380522-56380544 CATGAGATTTAGAAGGAGGCAGG - Intergenic
1110819329 13:79896376-79896398 CAGGAGAAAGAGAGTGAGAGGGG + Intergenic
1110852200 13:80258646-80258668 CAGGAGAAAAAGAGGGAGAGTGG + Intergenic
1110936968 13:81303557-81303579 CAGGAGAATTACTGGAAGCCAGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1112351837 13:98641949-98641971 CAGGACAATGACAGTGAGACAGG - Intergenic
1114587136 14:23825523-23825545 CAGGGGAACTAGAGTGAGAGGGG - Intergenic
1114646371 14:24258734-24258756 CAGGAGTATCAGGGGGAGAAGGG + Intronic
1114671859 14:24415761-24415783 CAGGAGAAGGAAAGGGAGACAGG - Exonic
1114913863 14:27236776-27236798 CAGGAGAATAAGAGCGAGCAAGG - Intergenic
1116202734 14:41819657-41819679 CAGGAGAAAGAGAGAGAGAGAGG + Intronic
1116475344 14:45332794-45332816 CAGGAGCAGTAGAGGGAGATTGG + Intergenic
1116655915 14:47653760-47653782 GAGGAGAGTCAGAGGGAGACAGG + Intronic
1117322010 14:54633498-54633520 GGGGACAAGTAGAGGGAGACAGG + Intronic
1117553591 14:56861388-56861410 GAGGAGACTGAGAGGGAGAATGG - Intergenic
1117794640 14:59379714-59379736 CAGGAGAGTCAGAGGGAGAGAGG + Intergenic
1118203351 14:63698294-63698316 AAGGAAAATAAAAGGGAGACTGG + Intronic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118341424 14:64896672-64896694 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341430 14:64896691-64896713 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341436 14:64896710-64896732 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341442 14:64896729-64896751 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341448 14:64896748-64896770 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341454 14:64896767-64896789 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341460 14:64896786-64896808 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118381613 14:65222267-65222289 CAGGATAGTTTGAGGGAGAAAGG + Intergenic
1120528089 14:85601038-85601060 CAGGAGGGTGAGAGGGAGATTGG + Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1122844941 14:104488350-104488372 GAGGAGAAATAGGAGGAGACAGG + Intronic
1122901599 14:104784419-104784441 CAGGAGGAGTCGAGGGAGCCTGG - Intronic
1124427441 15:29573701-29573723 CAGGAGAAGGAGAGGAAGAGGGG - Intergenic
1127481815 15:59384832-59384854 GAGGAAAATTAGATGAAGACTGG - Intronic
1127503179 15:59573603-59573625 CTGGAGATGTAGATGGAGACAGG + Intergenic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1127867752 15:63045505-63045527 CTGGAGAATTTGCGGGAGGCAGG - Intronic
1127886517 15:63206411-63206433 CAGGAAAATGAGGGGGAGAGGGG - Intronic
1128977269 15:72162952-72162974 CAGGAAAATTGGAGAGAGAGAGG - Intronic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1130720975 15:86385974-86385996 GAGGAGGATGAGAGGGAGAGGGG - Intronic
1130720992 15:86386019-86386041 GAGGAGGATGAGAGGGAGAGGGG - Intronic
1131070705 15:89463944-89463966 CAGGTGAAATAGATGGAGAGTGG - Intergenic
1131873921 15:96784956-96784978 GAGGATAATTAGAGGCAGAATGG - Intronic
1131946180 15:97624417-97624439 CAGGAGAAATAGAGCGAGTGGGG - Intergenic
1132420238 15:101659592-101659614 TAGGAGATGGAGAGGGAGACAGG - Intronic
1134914423 16:18058067-18058089 CAGGAGCAAGAGAGAGAGACTGG + Intergenic
1136611151 16:31366388-31366410 CAGGAGAGGGAGAGAGAGACAGG - Intronic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137372913 16:47925428-47925450 CAGGTGTATGAGAGAGAGACGGG + Intergenic
1138621358 16:58213751-58213773 AAAGAGAATTAGAGGGAAAAGGG - Intergenic
1138904253 16:61311108-61311130 AAAAAGAATTAGAGGGAGATGGG + Intergenic
1138993581 16:62421224-62421246 CAGCAAAATCAGAGAGAGACTGG + Intergenic
1139076791 16:63461159-63461181 CAGGAGTATTAAAGAGAGAATGG + Intergenic
1141739815 16:85883755-85883777 CAGGAGAATAAGGAGGACACAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1143410884 17:6707788-6707810 CTGGAGACTTAGAAGCAGACAGG + Intronic
1144442265 17:15294193-15294215 CAGGAGAATGGGAGCGAGCCCGG - Intergenic
1145733431 17:27211256-27211278 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733443 17:27211294-27211316 CGGGAGAGGCAGAGGGAGACGGG - Intergenic
1145733448 17:27211313-27211335 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733462 17:27211357-27211379 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733468 17:27211376-27211398 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733474 17:27211395-27211417 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145840530 17:27990433-27990455 CAGGAGCAAGAGAGGGAGAGTGG - Intergenic
1146590906 17:34127298-34127320 CATGAGAGTTAGAGACAGACTGG - Intronic
1146672975 17:34754661-34754683 CAGGAGTAGAAGAGAGAGACGGG + Intergenic
1150281549 17:63932058-63932080 CAGGGCCATGAGAGGGAGACAGG + Intronic
1151221547 17:72616460-72616482 CTGCAGAATTAGAGGCAGCCTGG - Intergenic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1153506488 18:5804394-5804416 CAGGAGAAAGAGAGGGAGAGAGG - Intergenic
1155428824 18:25734289-25734311 CAGGAGAAAGAGAGAGAGAGTGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157567926 18:48692424-48692446 TGGGAGAATTAGAGGCAGAGAGG - Intronic
1157789681 18:50520452-50520474 CCGGAGAAAGAGAGGGAGATGGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158739192 18:60120328-60120350 CAATAGCATTAGAGGGAGATGGG - Intergenic
1159796538 18:72851109-72851131 CAGGAAAATTCGTGGGAGATCGG + Intronic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1160614111 18:80110569-80110591 GAGGAGCATTAGTGGGAGAGAGG + Intronic
1162943961 19:14031417-14031439 CAGGGGAGTTGGAGGGAGAGGGG - Intergenic
1164066236 19:21720258-21720280 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066242 19:21720277-21720299 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066248 19:21720296-21720318 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066254 19:21720315-21720337 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066260 19:21720334-21720356 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066266 19:21720353-21720375 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164596433 19:29533447-29533469 AAGGAGACTTGGAGAGAGACTGG - Intronic
1166328712 19:42066646-42066668 GAGGAGAGTTACAGGGAGGCAGG + Intronic
1167291116 19:48625758-48625780 CAGGAGCATCAGAGACAGACAGG - Intronic
1167574087 19:50309473-50309495 CAAGAGAAATGGAGGGAGACGGG - Intronic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1168038726 19:53740867-53740889 CAGGAGAATCACAGGAAGCCGGG + Intergenic
1168353713 19:55689915-55689937 GAGGAGAGCAAGAGGGAGACTGG + Exonic
925140299 2:1545606-1545628 CAGGAGAATTTCAGGCAAACTGG + Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
927144497 2:20153687-20153709 GAGGAGAATGAGAGTGAGATCGG + Intergenic
927758065 2:25724711-25724733 CATCAGAATTGGAGGGACACTGG - Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
929815062 2:45223832-45223854 CAGGAGAACCTCAGGGAGACTGG + Intergenic
930209004 2:48615465-48615487 AAGGAGAGGGAGAGGGAGACGGG + Intronic
930209010 2:48615484-48615506 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209016 2:48615503-48615525 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209022 2:48615522-48615544 CGGGAGAGGGAGAGGGAGACGGG + Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931751864 2:65338174-65338196 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751870 2:65338193-65338215 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751876 2:65338212-65338234 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751886 2:65338244-65338266 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751892 2:65338263-65338285 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751898 2:65338282-65338304 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751904 2:65338301-65338323 AAGGAGAGGGAGAGGGAGACGGG - Intronic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
931931133 2:67135375-67135397 GAGCAGAATTGGAGGGGGACGGG - Intergenic
932342563 2:70975552-70975574 CAGGTGATTTTGAGGGAGAAGGG - Intronic
933731767 2:85461717-85461739 AAGCAGAATTGGAGGGAAACTGG + Intergenic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934706486 2:96485135-96485157 CAAGAGCATTTGAGGGAGTCAGG + Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
935935505 2:108178035-108178057 CAGCAGCATTTGAGGGAGAAAGG + Intergenic
935992225 2:108729694-108729716 CAGGAAATTAAGAGGGAGTCAGG + Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
937620892 2:123983947-123983969 CAGGACAATTACAGAGAGAAGGG + Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937834739 2:126460889-126460911 CAGGCCAATGAGAGGGAAACGGG - Intergenic
937909425 2:127068395-127068417 CGAGAGAATTAGGGGGAGCCCGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938570845 2:132560641-132560663 CTGGAGAGCTATAGGGAGACTGG - Intronic
939297425 2:140286339-140286361 GAGGAGTAAAAGAGGGAGACTGG + Intronic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941803483 2:169687223-169687245 CATGAGATTTAGAGGGGGCCAGG - Intronic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
943539008 2:189188056-189188078 CAGCAGAATGAGAGGGTGAGTGG - Intergenic
943773168 2:191741099-191741121 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773174 2:191741118-191741140 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773195 2:191741182-191741204 CGGGAGAGGGAGAGGGAGACAGG - Intergenic
943773200 2:191741201-191741223 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773206 2:191741220-191741242 AAGGAGAGGGAGAGGGAGACGGG - Intergenic
944523816 2:200598116-200598138 AAGGAGAAAAAGAGGGAGAGAGG + Intronic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
944652550 2:201845992-201846014 AAGGATAATTAGAGAGGGACAGG - Intronic
945090542 2:206172591-206172613 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
945090548 2:206172610-206172632 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090554 2:206172629-206172651 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090560 2:206172648-206172670 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090566 2:206172667-206172689 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090572 2:206172686-206172708 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090578 2:206172705-206172727 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090616 2:206172823-206172845 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090662 2:206172967-206172989 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090668 2:206172986-206173008 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090678 2:206173018-206173040 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090688 2:206173050-206173072 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090694 2:206173069-206173091 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090700 2:206173088-206173110 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090706 2:206173107-206173129 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
945970615 2:216227547-216227569 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970621 2:216227566-216227588 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970627 2:216227585-216227607 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970633 2:216227604-216227626 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970643 2:216227636-216227658 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970649 2:216227655-216227677 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970655 2:216227674-216227696 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970661 2:216227693-216227715 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970667 2:216227712-216227734 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970673 2:216227731-216227753 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970679 2:216227750-216227772 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
946254016 2:218430249-218430271 AAGGAGAAATGGAGGGAGGCTGG + Intronic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
947096094 2:226568538-226568560 CAGGAGCAAGAGAGGGAGAGAGG - Intergenic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948635204 2:239330196-239330218 CAGGAGAGCCAGAGGGACACTGG + Intronic
1169085318 20:2822528-2822550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085340 20:2822598-2822620 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085346 20:2822617-2822639 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085352 20:2822636-2822658 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085358 20:2822655-2822677 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085364 20:2822674-2822696 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085370 20:2822693-2822715 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085376 20:2822712-2822734 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085382 20:2822731-2822753 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085388 20:2822750-2822772 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085394 20:2822769-2822791 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085400 20:2822788-2822810 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085406 20:2822807-2822829 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085412 20:2822826-2822848 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085418 20:2822845-2822867 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085424 20:2822864-2822886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085430 20:2822883-2822905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085436 20:2822902-2822924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085442 20:2822921-2822943 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085448 20:2822940-2822962 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085454 20:2822959-2822981 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085460 20:2822978-2823000 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169289403 20:4335800-4335822 CAGGAAAAAGAGAGAGAGACGGG - Intergenic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1173191528 20:40880450-40880472 CAGGGGCACTAGAGGGAGACTGG + Intergenic
1173560600 20:44002755-44002777 CAGGAGAATGAGAGAGAGAGAGG + Intronic
1173897439 20:46561792-46561814 TCGGAGGATTAGAGGGAGTCGGG + Intronic
1173980909 20:47223411-47223433 CAGGAGAATCAGTGGAAGCCAGG + Intronic
1174107548 20:48173391-48173413 CAGGACAATTACAGGCAAACTGG - Intergenic
1174513398 20:51072994-51073016 CAGGAGAAATGGAGAGAGCCAGG - Intergenic
1174721641 20:52819195-52819217 TAGGAGAAATAATGGGAGACGGG - Intergenic
1175493191 20:59393130-59393152 AAGGAGAGTTAGAGGCAGAACGG - Intergenic
1175541511 20:59750974-59750996 CAGGAGGATTAGGGACAGACAGG - Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175603181 20:60291369-60291391 CAGGAGAAGTGGAGGGAGACAGG + Intergenic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1176886771 21:14265807-14265829 CAGGAGAAACAGAGAGAGAGCGG - Intergenic
1177529352 21:22340202-22340224 CATGAGATTTGGAAGGAGACAGG - Intergenic
1178467769 21:32864108-32864130 CAGGAGAATTACTGGGATTCAGG + Intergenic
1179195025 21:39156588-39156610 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1179195039 21:39156632-39156654 AAGGAGAGGGAGAGGGAGACGGG - Intergenic
1179893076 21:44347101-44347123 CAGGAGTAAGAGAGAGAGACAGG + Intergenic
1181640049 22:24191518-24191540 CAGGAGACCTAGTGGGAGGCTGG - Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182056239 22:27357434-27357456 CAGGAGGAAGAGAGGGAGAGAGG - Intergenic
1182151963 22:28034216-28034238 GAGGATAACTCGAGGGAGACAGG + Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183795505 22:40113762-40113784 CAGGAGACTTGGTGGCAGACAGG - Intronic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1183871898 22:40746386-40746408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871904 22:40746405-40746427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871910 22:40746424-40746446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871924 22:40746468-40746490 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871930 22:40746487-40746509 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871936 22:40746506-40746528 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871942 22:40746525-40746547 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871948 22:40746544-40746566 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871954 22:40746563-40746585 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871964 22:40746595-40746617 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
949725643 3:7041268-7041290 CAGGAGAATTAGAGGGAGACAGG - Intronic
950132794 3:10558825-10558847 CAGGAGAAGGAAAGGAAGACAGG + Intronic
951656060 3:25009754-25009776 CAGAAGACTTAGAGGGGGATGGG + Intergenic
953098969 3:39807623-39807645 TAGGAGAATAGGAGGGAGAAAGG - Intergenic
954865185 3:53722940-53722962 CTGGAGAGGTAGAGGGAAACGGG - Intronic
955981582 3:64532703-64532725 CTGGAGAATTAGAGATACACAGG - Intronic
956953035 3:74304296-74304318 TAGGAGAAGGAGAGGGAGAGAGG - Intronic
957803371 3:85115504-85115526 CAGGAGGACTAGAATGAGACTGG + Intronic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958267613 3:91457839-91457861 CAGGAGAATTGCTTGGAGACAGG + Intergenic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
961766106 3:129212197-129212219 AAGCAGACTCAGAGGGAGACAGG - Intergenic
962083342 3:132164217-132164239 CAGGAGAGTTAGTGGCATACAGG + Intronic
962219296 3:133550389-133550411 CAGGAGAATTAGCGTGAACCCGG - Intergenic
962390309 3:134966210-134966232 CAAGAGAATGAGAGTGAGCCTGG + Intronic
962501250 3:135995562-135995584 CAGGAGAATTAAAGGAACCCGGG - Intronic
962587454 3:136856777-136856799 AAAGGGCATTAGAGGGAGACTGG + Intergenic
962589073 3:136870611-136870633 CAGCAGAATTACTGGGAGACAGG - Intronic
962799237 3:138875889-138875911 CAGGAGGAAAAGTGGGAGACAGG - Intergenic
963455672 3:145543650-145543672 CAGGAGATTTGGATGGAGACAGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964022348 3:152028285-152028307 TAGGAGACTCAGAGGGAGAGAGG + Intergenic
964298708 3:155263043-155263065 CAGGAGGAAGAGAGAGAGACAGG - Intergenic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
967565145 3:190963411-190963433 CATGAGATTTTGGGGGAGACAGG + Intergenic
967724076 3:192845169-192845191 CAGAAGGATTATAGGGTGACTGG + Intronic
969355216 4:6621069-6621091 CAGGAGGGTGAGAGGGAGGCTGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969889163 4:10243689-10243711 CAGCAGACTGTGAGGGAGACTGG + Intergenic
969984236 4:11190616-11190638 CAGGAGAATTTGGGAGGGACAGG - Intergenic
970262213 4:14238422-14238444 CATGAGAATTGGAGGGAAAGAGG + Intergenic
971078086 4:23173714-23173736 TAGGAGAAATAGAGAGAGACTGG - Intergenic
971941779 4:33224773-33224795 CAGGAGAGATAGAGAGAGAAAGG - Intergenic
972345774 4:38191125-38191147 CAGGACAACTGGAGGGAGAGAGG - Intergenic
972886281 4:43493218-43493240 CAGGAAAAATAGAGGGAGCTGGG + Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
973679937 4:53307021-53307043 CAGGAGATTTAGAGGGTGAGAGG - Intronic
974525208 4:63042510-63042532 TATGAGAATTAGAAGGAGCCAGG - Intergenic
974540953 4:63234476-63234498 CAGGAGAATCAGTTGGACACGGG + Intergenic
977677506 4:99764137-99764159 CAGGAAAAGTAGAGAGAGAAGGG - Intergenic
978765426 4:112400441-112400463 CAGGAGAATTAGAGGAATTTTGG + Intronic
981307315 4:143260477-143260499 CAGGAGAAAAAGAGAGAGATGGG - Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982671271 4:158322640-158322662 CAGGAGCAATAGAGAGTGACAGG + Intronic
985968288 5:3354167-3354189 AGGGAGAATAAGATGGAGACGGG + Intergenic
987178001 5:15336462-15336484 CAGGAGAATTTGAGTGAGAGTGG + Intergenic
989227239 5:39043470-39043492 GAGGAGAAATAGAGAAAGACTGG + Intronic
989264928 5:39462558-39462580 CAGTGGATTTAGAGGGAGCCCGG - Intergenic
989706116 5:44332882-44332904 CAAGAGAATGAGAAGGAGACGGG + Intronic
990108331 5:52292510-52292532 CATGAGATTTGGAAGGAGACAGG - Intergenic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
991073994 5:62514584-62514606 AAGGAGAGGGAGAGGGAGACGGG + Intronic
991204693 5:64037563-64037585 CAGGAGAGAGAGAGGGAGAGGGG - Intergenic
993102490 5:83558061-83558083 CAGTTGAATGCGAGGGAGACCGG - Intronic
993650891 5:90520824-90520846 CAGGAGAATTACTGGAAGCCGGG + Intronic
994625416 5:102212730-102212752 CAGGAGAAGTAGAGTGAAAGAGG + Intergenic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
996382739 5:122878318-122878340 CAGGAGAATGAGGTGGAGAAGGG + Intronic
996955133 5:129174419-129174441 TAGGAGATCAAGAGGGAGACAGG + Intergenic
996960783 5:129246639-129246661 CAGGAGAGTTAAAGTGAGAGAGG + Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
998093477 5:139384088-139384110 CAGGAGCATTAGATGGAGCGTGG + Intronic
998498635 5:142613015-142613037 CAGGAGACATAGAAGAAGACAGG - Intronic
999116535 5:149169097-149169119 AAGGAGAGTTAGGGTGAGACGGG - Intronic
999157909 5:149471745-149471767 CAGAAGAAATACAGGGACACAGG - Intergenic
999284266 5:150384721-150384743 CAGGAGGATTCGGGGAAGACGGG + Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1000361683 5:160453458-160453480 CAGGAGAATTCATGGGATACTGG - Intergenic
1000642661 5:163721077-163721099 CAGGAGAATTATAGAGAGAATGG - Intergenic
1001167587 5:169384761-169384783 AAGCTGAATTAGAGGGAGGCAGG + Intergenic
1001770250 5:174290502-174290524 TGGGAGAATAAGAGGGAGAGAGG - Intergenic
1002724668 5:181286572-181286594 CAGTAGGTTTAGAGGGAGAGTGG - Intergenic
1005667155 6:28069655-28069677 CAGGGGACTTTGAGGGAGATGGG - Intergenic
1005836967 6:29717718-29717740 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836973 6:29717737-29717759 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836979 6:29717756-29717778 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836985 6:29717775-29717797 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836991 6:29717794-29717816 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836997 6:29717813-29717835 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837014 6:29717864-29717886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837020 6:29717883-29717905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837026 6:29717902-29717924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006507915 6:34502351-34502373 AAGGAGAAACAGAGGGAAACAGG + Intronic
1006655223 6:35586100-35586122 GATGAGAATTAGAGGGAGAATGG - Intronic
1006800451 6:36756447-36756469 AAGGAGGATTTGTGGGAGACTGG + Intronic
1006908073 6:37546184-37546206 AAGGAGGAATAGCGGGAGACAGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007353142 6:41289893-41289915 TAGGGGCATTAGAGGGAGATTGG - Intergenic
1007605416 6:43114427-43114449 AGGGAGAAACAGAGGGAGACAGG - Intronic
1008353922 6:50528730-50528752 CTGTAGAATAATAGGGAGACAGG - Intergenic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1008926791 6:56896008-56896030 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926797 6:56896027-56896049 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926803 6:56896046-56896068 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926809 6:56896065-56896087 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926815 6:56896084-56896106 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926821 6:56896103-56896125 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926827 6:56896122-56896144 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008987601 6:57563751-57563773 CAGGAGAATTGCTTGGAGACAGG - Intronic
1009176204 6:60462356-60462378 CAGGAGAATTGCTTGGAGACAGG - Intergenic
1009640934 6:66335184-66335206 AAGGAGAATTAGAAGAAGAGAGG - Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011047743 6:83105000-83105022 CAGGAGAATAACAAGGAGAGTGG - Intronic
1011260677 6:85466517-85466539 CAGAAGAATTAGAGGACCACAGG + Intronic
1011961779 6:93100058-93100080 AAGGAGAAGTAGAGGAAGATGGG - Intergenic
1012819008 6:104061363-104061385 AAAGAGAATTAGAGAGAGAAGGG + Intergenic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1014764414 6:125390118-125390140 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764420 6:125390137-125390159 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764426 6:125390156-125390178 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764432 6:125390175-125390197 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014918459 6:127183001-127183023 CAAGAGAAATAGAGGAAGAGAGG - Intronic
1015442834 6:133268796-133268818 CAGGAGGAGAAGAGGGAGAGTGG + Intronic
1017013767 6:150083575-150083597 CAGGAGAATCATCTGGAGACCGG + Intergenic
1017371181 6:153710988-153711010 CAGGAGGAAGAGAGAGAGACGGG + Intergenic
1020240149 7:6388115-6388137 CAGCAGAATTGGGTGGAGACAGG + Intronic
1021013088 7:15495866-15495888 CAAGAGAATGAGAGAGAGAGAGG - Intronic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023648904 7:42348159-42348181 CATCAGAAAGAGAGGGAGACAGG + Intergenic
1023854678 7:44175481-44175503 CAGGAGAATGAGAGGGGGCCAGG + Intronic
1024247207 7:47479513-47479535 CAGGAGGAATGGAGTGAGACTGG + Intronic
1024670125 7:51586557-51586579 CAGCAAACTTAGAGGGAGTCAGG - Intergenic
1024906495 7:54388107-54388129 CATGAGAATTGTAGGGAGATGGG + Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026837613 7:73648851-73648873 GAGGAGAATGAGAGAGAGAGGGG - Intergenic
1027654193 7:80908727-80908749 CAGAAAAATGGGAGGGAGACAGG + Intronic
1028115736 7:86995584-86995606 CAGGAGGATAACAGGGAGCCAGG - Intronic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1029404654 7:100367223-100367245 CAGGAGAATTTGTGGCAGGCTGG - Intronic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1030861674 7:114639440-114639462 CAGTTGTATTAGAAGGAGACTGG + Intronic
1031288220 7:119899840-119899862 CAGGAGAAAAAGAGAGAGATGGG + Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1033256565 7:139806653-139806675 CAGGAGACAGAGAGGGAGACAGG - Intronic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036971832 8:13364097-13364119 CAGGAGAATGAAAGAGAGAAAGG + Intronic
1037657206 8:20895162-20895184 CAGGAGGATTAAAAGGAGAGTGG - Intergenic
1038760877 8:30384021-30384043 CATGAGAACTCGAGGGACACCGG - Intergenic
1039092114 8:33843334-33843356 AAGGAGCATCAGAGGGAGACTGG + Intergenic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1041357855 8:57021161-57021183 CGGGAGAGCGAGAGGGAGACGGG - Intergenic
1041357859 8:57021180-57021202 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1041357865 8:57021199-57021221 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1041967525 8:63697057-63697079 CATGAGAATTACAGAGATACTGG + Intergenic
1042393750 8:68266272-68266294 AAGGAGAAACTGAGGGAGACAGG + Intergenic
1043606932 8:82012294-82012316 CAGGAGAATTTGTGGTTGACGGG + Intergenic
1044619735 8:94177121-94177143 AAGGAGAAAGAGAGGGAGACGGG + Intronic
1045262139 8:100585477-100585499 AAGCAGAATTAGAGGGAAAATGG + Intronic
1045870790 8:106924639-106924661 CAGGAGAATAAGTTGGAGATAGG - Intergenic
1046678249 8:117137108-117137130 CAGGAGATGTAGACGGAGAAGGG - Intronic
1046759737 8:118009006-118009028 CAGGAGATTTAAAAGGAAACGGG + Intronic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1050818492 9:9846868-9846890 CAGGAGAATTAAAGAGAGTAGGG + Intronic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1051095595 9:13462025-13462047 CAGGAAAGTTTGAGGGAAACAGG + Intergenic
1051453606 9:17226861-17226883 CAGGAGCAAGAGAGAGAGACAGG + Intronic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1053463895 9:38290967-38290989 CAGGAGTATGAGAGGCAGAGAGG + Intergenic
1053545782 9:39021411-39021433 CAGGTGAATTCTGGGGAGACGGG - Intergenic
1055431178 9:76245831-76245853 CAGGATAATTAAAGGGAGAGAGG + Intronic
1055884876 9:81049857-81049879 AAGGAGGAAAAGAGGGAGACAGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1060436030 9:123593948-123593970 CAGGAGAAAGAGAGAGAGAGGGG - Intronic
1060439668 9:123626941-123626963 CAGGAGAGGAAGAGGCAGACAGG + Intronic
1187791731 X:22957750-22957772 GGGGAGAATTATAGGGAGAAAGG - Intergenic
1187793157 X:22972820-22972842 CATGAGACTGAGAGGGAGAACGG - Intergenic
1187912111 X:24120594-24120616 CTGGATAATTAGAGGGACAGAGG - Intergenic
1188095194 X:26012627-26012649 AGGGAAAATTAGAGGGAGAGAGG + Intergenic
1188113373 X:26217044-26217066 CAGGAGAATGAGTAGGAGAACGG - Intronic
1188355260 X:29182887-29182909 CAGGAGAGTTAGAGTCAGAGAGG + Intronic
1189724461 X:43954633-43954655 TAGGAGAAATGGAGGGAGTCAGG - Intronic
1190220333 X:48508862-48508884 CAGGAGGATTGAGGGGAGACCGG - Intergenic
1190451482 X:50585569-50585591 CAGGTCAATTAGAGGGAGCTGGG + Intergenic
1192106771 X:68325616-68325638 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1192474643 X:71429673-71429695 GAGGAGAATAAGACAGAGACCGG + Intronic
1192552317 X:72064355-72064377 CAGCAGAATGAAAAGGAGACAGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194447946 X:94009810-94009832 CATGAGAATTATAGGGAGATGGG + Intergenic
1195425299 X:104722453-104722475 GAGGATATTGAGAGGGAGACAGG + Intronic
1195854140 X:109311807-109311829 CAGGAAAATTCTAGGCAGACAGG - Intergenic
1195887795 X:109658370-109658392 CAGATGAATTTGAGGGGGACTGG - Intronic
1197989507 X:132302686-132302708 CAGGAGAATTTGGGGGAAACTGG - Intergenic
1198137855 X:133772039-133772061 CAGGAGAAGGAAAGGGACACAGG - Intronic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic