ID: 949729958

View in Genome Browser
Species Human (GRCh38)
Location 3:7097426-7097448
Sequence CTCCATATAATACTTCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949729958_949729960 12 Left 949729958 3:7097426-7097448 CCTGAAAGAAGTATTATATGGAG 0: 1
1: 0
2: 1
3: 23
4: 185
Right 949729960 3:7097461-7097483 TCCTGAAACATTTTATCCTGTGG 0: 1
1: 0
2: 2
3: 25
4: 247
949729958_949729964 17 Left 949729958 3:7097426-7097448 CCTGAAAGAAGTATTATATGGAG 0: 1
1: 0
2: 1
3: 23
4: 185
Right 949729964 3:7097466-7097488 AAACATTTTATCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 240
949729958_949729962 13 Left 949729958 3:7097426-7097448 CCTGAAAGAAGTATTATATGGAG 0: 1
1: 0
2: 1
3: 23
4: 185
Right 949729962 3:7097462-7097484 CCTGAAACATTTTATCCTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 196
949729958_949729963 14 Left 949729958 3:7097426-7097448 CCTGAAAGAAGTATTATATGGAG 0: 1
1: 0
2: 1
3: 23
4: 185
Right 949729963 3:7097463-7097485 CTGAAACATTTTATCCTGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949729958 Original CRISPR CTCCATATAATACTTCTTTC AGG (reversed) Intronic
904463435 1:30693835-30693857 CTACATAGAATAAATCTTTCAGG + Intergenic
904595611 1:31643231-31643253 CTGCATATTATATTCCTTTCTGG + Intronic
905965377 1:42089376-42089398 TTCCATTTAATTCTTCTTTCTGG - Intergenic
907166929 1:52420720-52420742 CACCAGATAGTACTTCTTTCTGG + Exonic
910081582 1:83348239-83348261 CTTCATATGTTATTTCTTTCTGG - Intergenic
910241537 1:85091980-85092002 TTCCAAATCATATTTCTTTCTGG - Intronic
914852607 1:151326373-151326395 CTCCACATACCACTTATTTCAGG - Exonic
916123086 1:161546602-161546624 CTGCATTTTTTACTTCTTTCAGG - Intronic
916132978 1:161627970-161627992 CTGCATTTTTTACTTCTTTCAGG - Intronic
916579265 1:166093095-166093117 TTCCAAACAATACTTCTCTCAGG - Intronic
916869091 1:168893005-168893027 CTCCATGTGTTACTTCTGTCTGG + Intergenic
917638629 1:176960784-176960806 CTCCTAATAGTCCTTCTTTCTGG + Intronic
919284902 1:195544573-195544595 CTCTATATCATACTGCTTACTGG - Intergenic
919494971 1:198253321-198253343 CTCCATACTACACTTGTTTCTGG - Intronic
920930497 1:210383412-210383434 CTCCATATTTTACTTTTTCCAGG - Intronic
921273245 1:213491242-213491264 CTCCATTAAAGCCTTCTTTCAGG - Intergenic
921304060 1:213778452-213778474 CTCCATATAAATTTCCTTTCGGG + Intergenic
923140630 1:231159580-231159602 CACCAAAAAATACTTCTATCAGG + Intergenic
923757230 1:236802823-236802845 CTCCTTCTAATCCTGCTTTCTGG - Intronic
924285263 1:242479547-242479569 CTCCATATAGTATGTCTTTACGG - Intronic
924788769 1:247223735-247223757 CCACATTTAATGCTTCTTTCAGG - Intergenic
1067299267 10:44994206-44994228 CTCCTTATCATTCTTCCTTCAGG - Exonic
1068345953 10:55778201-55778223 CTCCATAGAAATCTTCTGTCAGG + Intergenic
1071433623 10:85626173-85626195 ATCCATATAATACTTCTCGAGGG + Intronic
1073666070 10:105535226-105535248 CTCCATATACTGCATCTTTTTGG + Intergenic
1074784589 10:116827737-116827759 CTCCAAATAAAGCTTCATTCTGG + Intergenic
1077962948 11:7094414-7094436 CTCCATATAAATGTTCTCTCTGG + Intergenic
1078127567 11:8583091-8583113 CTCCTTATAAAACTTCTTACAGG + Intronic
1079810263 11:24989985-24990007 CTCCATTTAATCCTACTTTTAGG + Intronic
1080649764 11:34212761-34212783 CTCCACTTAACACTTCATTCTGG + Intronic
1084841951 11:71860153-71860175 CTTCATTTAATGCTTCTTCCTGG - Intergenic
1085205231 11:74727732-74727754 CTCCATCCAATCCTGCTTTCAGG - Intronic
1090237111 11:125157431-125157453 CTCCAGAAACTACTTCATTCAGG - Intergenic
1090632624 11:128663390-128663412 TTCTTTATAATACTTATTTCTGG - Intergenic
1097455915 12:59797876-59797898 CTACATTTAATGCTTCCTTCAGG - Intergenic
1098366032 12:69703980-69704002 TTCCTGTTAATACTTCTTTCTGG + Intergenic
1098384185 12:69901276-69901298 CACAATATACTACCTCTTTCTGG - Intronic
1098999158 12:77157181-77157203 CTCCATTCAGTACTTCTTGCAGG - Intergenic
1099626110 12:85076552-85076574 TTCTAGATAATACTGCTTTCTGG + Intronic
1104806972 12:131595816-131595838 CTCAATATAATACTGCTTACAGG + Intergenic
1105073387 12:133252265-133252287 TTCCATATAAGATTTTTTTCTGG + Intergenic
1106167365 13:27260258-27260280 CTCCTTAAAATACTTCCATCAGG - Intergenic
1108454664 13:50600951-50600973 TGCCATATATTACATCTTTCTGG - Intronic
1109419585 13:62094046-62094068 CTTCATGTTATACTTCTCTCTGG + Intergenic
1110043051 13:70789825-70789847 CTCCATACTATTTTTCTTTCTGG - Intergenic
1112824802 13:103380084-103380106 TTGCATAAAATACTTCTTTAGGG + Intergenic
1113050945 13:106211276-106211298 CAACAAATTATACTTCTTTCCGG + Intergenic
1113253714 13:108484527-108484549 CTCAATATAATTCTTCTTATGGG - Intergenic
1114554605 14:23554718-23554740 CTCCCTATAATACCTCTCACTGG + Intronic
1116660369 14:47702148-47702170 CTCAATAAAACACATCTTTCTGG - Intergenic
1117289266 14:54316744-54316766 CTGCATCTATCACTTCTTTCAGG - Intergenic
1117532847 14:56675996-56676018 CTCCATTTACTACTACTTTTCGG + Intronic
1118427306 14:65680060-65680082 GACCTTATAATACATCTTTCAGG - Intronic
1122731881 14:103806326-103806348 TACCATCTACTACTTCTTTCTGG + Intronic
1124174638 15:27412017-27412039 CTTCGTATAATATTTATTTCTGG + Intronic
1129426307 15:75465708-75465730 CTCCATAAAATGCTGATTTCTGG - Exonic
1131555991 15:93399406-93399428 CGCCATAGAATGTTTCTTTCTGG + Intergenic
1132121356 15:99178889-99178911 TTCCCTACAATTCTTCTTTCTGG - Intronic
1132192230 15:99875900-99875922 CTCCATAAAATACGTTTTACTGG + Intergenic
1139061486 16:63258345-63258367 CTCCATTTAATAATTCATGCTGG - Intergenic
1144377067 17:14654509-14654531 TTCCATATTAGTCTTCTTTCTGG + Intergenic
1144938665 17:18920556-18920578 CTACATAGAATACTTTTTTAAGG + Intronic
1146071359 17:29685081-29685103 CTCCATATTATAATTGTTTGTGG - Intronic
1146384993 17:32363100-32363122 GTCCATATAACACTTCTCACAGG - Intronic
1149167010 17:53764071-53764093 CCCCATATAATTCTTCTTTCAGG - Intergenic
1149877747 17:60254755-60254777 CTCCTTATGATTCATCTTTCTGG + Intronic
1151187878 17:72377354-72377376 CTCCACACAGTGCTTCTTTCTGG - Intergenic
1151634556 17:75336695-75336717 TTCCATATTTTCCTTCTTTCTGG - Intronic
1153313847 18:3702915-3702937 CTCCATCTTATACTCCTTTCTGG - Intronic
1155575493 18:27241413-27241435 CTCAAAACAATACTTCTTTCTGG + Intergenic
1160044880 18:75377251-75377273 GTAAATATATTACTTCTTTCAGG + Intergenic
1160359663 18:78262828-78262850 CTTCACAAAATACTTTTTTCAGG + Intergenic
1163229332 19:15989632-15989654 TTTCATATATGACTTCTTTCTGG + Intergenic
1164602663 19:29573560-29573582 CTGCATATTATATTTTTTTCAGG - Intergenic
1167350749 19:48972838-48972860 CTAAATATAATACATCTGTCAGG + Intronic
925311410 2:2886703-2886725 TTCCCTGTAATACTTCTTGCAGG - Intergenic
926749248 2:16185543-16185565 CTCCATGTAATACTAATTTTTGG + Intergenic
926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG + Intergenic
927401723 2:22720164-22720186 CATCATATAAAACATCTTTCAGG - Intergenic
927458681 2:23278847-23278869 CTCTAAAGAATACTTCCTTCTGG - Intergenic
928703384 2:33922012-33922034 TTCCATCTAATACTCTTTTCAGG + Intergenic
928850229 2:35736145-35736167 CTACATTTAGTGCTTCTTTCAGG - Intergenic
930727664 2:54697518-54697540 CTCCATTTAATATTTCTTGCAGG - Intergenic
931770142 2:65490307-65490329 CTCCAAATAAGACCACTTTCTGG - Intergenic
932066356 2:68566288-68566310 CTCCTTATAATATATCTTTTAGG - Intronic
937139910 2:119590945-119590967 CCCCATAAAATGCTTCTTGCTGG + Intronic
938987644 2:136594842-136594864 CTCCCTTTAACACTTATTTCAGG + Intergenic
939307105 2:140426376-140426398 CTCAATGAAATATTTCTTTCAGG + Intronic
940304971 2:152215910-152215932 CTCAATCTAATACTTTTTTCTGG - Intergenic
941101457 2:161300473-161300495 CTCCATGGATTATTTCTTTCAGG - Intergenic
943693310 2:190892588-190892610 CTCCCTAAATTAATTCTTTCTGG - Intronic
944198098 2:197076479-197076501 CTTCATTTAATACTTGTTTTGGG + Intronic
1168933309 20:1642721-1642743 CCACATTTAGTACTTCTTTCAGG + Intronic
1173910888 20:46669948-46669970 ATCCATATAAAACTTCATGCTGG + Intronic
1174128033 20:48322271-48322293 CTTCATATAGCACTTCTTCCTGG + Intergenic
1177522624 21:22247811-22247833 CTCAATATTATACTACTTTAAGG - Intergenic
1177582536 21:23044505-23044527 CTGCCTAAAACACTTCTTTCTGG + Intergenic
1177680706 21:24366065-24366087 CTACATATATTAACTCTTTCGGG - Intergenic
1178216037 21:30599321-30599343 ATCCAAATAATACTTTTTTCAGG + Intergenic
1179451603 21:41472181-41472203 CCCCACATCATCCTTCTTTCTGG + Intronic
1180744691 22:18079336-18079358 CTCCAGATCATCCTTCTTTGTGG - Intronic
949729958 3:7097426-7097448 CTCCATATAATACTTCTTTCAGG - Intronic
950623182 3:14224364-14224386 CTCCTGATACTGCTTCTTTCAGG - Intergenic
952602273 3:35099533-35099555 CTCAATACTATACTTCTTTATGG + Intergenic
956533848 3:70253242-70253264 CTCCCTCTATTACTTCTTTCAGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957291557 3:78283285-78283307 CTACATTTAGTACCTCTTTCAGG - Intergenic
958107585 3:89096775-89096797 CTGCATATAATGATTATTTCTGG + Intergenic
959017061 3:101146972-101146994 CTCTATATAATATTTCTTAAAGG - Intergenic
959641613 3:108644211-108644233 CTTCATATAATTATTATTTCTGG + Exonic
960297281 3:115959695-115959717 ATCCATATATTACTTCATTTAGG - Intronic
960328840 3:116331647-116331669 CTCCATGAAGTACTTCTTTCAGG - Intronic
963461966 3:145625944-145625966 AACCATATAATGGTTCTTTCAGG - Intergenic
963681091 3:148377927-148377949 CTCTATATAATACATCCTTAAGG - Intergenic
966171043 3:177080543-177080565 CTACTCATAATACTTTTTTCTGG + Intronic
966591833 3:181692778-181692800 CTCCAAATAGTACATCTTTCTGG + Intergenic
967288703 3:187898529-187898551 CTCCACATAATCCTTCTTTATGG - Intergenic
969128286 4:4970571-4970593 CTGCATATAATGCTGTTTTCTGG + Intergenic
969783064 4:9426185-9426207 CTTCATTTAATCCTTCTTCCTGG - Intergenic
970055666 4:11968829-11968851 CTCCTTCTAAAACATCTTTCTGG - Intergenic
974504579 4:62752201-62752223 ATCCATATAATTCATTTTTCTGG + Intergenic
974989200 4:69063575-69063597 TTCCACATAATCCTTCTTTTTGG - Intronic
975246279 4:72124317-72124339 CTCTATAAAATACTTTTGTCAGG - Intronic
975863509 4:78702631-78702653 CTCCCTCTAACACTTCCTTCAGG + Intergenic
976321078 4:83716329-83716351 CTCAATGTGGTACTTCTTTCTGG - Intergenic
978940214 4:114427793-114427815 TTCCATATTATGCTTCCTTCAGG + Intergenic
979033711 4:115684529-115684551 CTCCATATTACACTTTTTACAGG - Intergenic
980287792 4:130803888-130803910 CTCCTTTTAGTATTTCTTTCAGG + Intergenic
981585602 4:146298962-146298984 CCCCAGACAATACTTCTTTTTGG - Intronic
982066240 4:151657215-151657237 GTGCATATAATGCCTCTTTCTGG - Intronic
983701788 4:170605602-170605624 CTCCAAATAATACTTTTCTTTGG - Intergenic
984072623 4:175134400-175134422 CTCCTTATGATACTTCTTATTGG - Intergenic
985909913 5:2870998-2871020 CTCCATATAATTGATCATTCAGG - Intergenic
986218395 5:5743534-5743556 CTCCATATCTTAGTTCTTTCAGG + Intergenic
986849907 5:11798803-11798825 CTCCATATAACAAGTATTTCAGG + Intronic
987150334 5:15033186-15033208 GTCCAAATAATACTCCATTCTGG + Intergenic
988478368 5:31608351-31608373 CTTAATATAATACATCTTTATGG + Intergenic
994946788 5:106404287-106404309 ATCCATATAATAATTCTATGAGG - Intergenic
996137601 5:119863767-119863789 CTCCATCTATTTCTGCTTTCTGG + Intergenic
997986294 5:138504051-138504073 CTCCATTTAATCCTTATTACAGG + Intergenic
998487996 5:142520325-142520347 CTCCATATTTTACATCTTCCAGG + Intergenic
999451877 5:151684809-151684831 CTTGAACTAATACTTCTTTCTGG - Intronic
1003436088 6:6089730-6089752 CTCCAGATAATACATTTATCTGG + Intergenic
1004076089 6:12345384-12345406 CTCCATATAATCCTAGATTCTGG - Intergenic
1004404702 6:15322083-15322105 CTAAATCTAATACTTCTTCCAGG - Intronic
1004505147 6:16241116-16241138 CTCCAGATATTACTTCTGCCAGG - Intronic
1009416863 6:63425484-63425506 CTCCAGATAATACTACTTAGTGG + Intergenic
1010720699 6:79280253-79280275 GACCATATATAACTTCTTTCTGG - Intergenic
1011377438 6:86705139-86705161 CTGTATTTAATACTTCCTTCAGG + Intergenic
1013818823 6:114131608-114131630 TTTCTTAAAATACTTCTTTCAGG + Intronic
1015093902 6:129391283-129391305 CTCAATATTATATTTCTTTTGGG - Intronic
1015357988 6:132302877-132302899 GTCCATATATTGGTTCTTTCTGG - Intronic
1015397523 6:132751882-132751904 TTCCTTAAAATTCTTCTTTCTGG + Intronic
1017353287 6:153470854-153470876 CTCCATGTAAGGCTTCTTTCTGG + Intergenic
1018539763 6:164865596-164865618 CTCCCTTTAATATTTCTTGCAGG - Intergenic
1020635769 7:10694169-10694191 CTCCAAATGATACTGGTTTCAGG - Intergenic
1021423108 7:20467530-20467552 ATTCATATATTACTTCTATCAGG - Intergenic
1021425823 7:20497859-20497881 CTATATTTAGTACTTCTTTCAGG - Intergenic
1021623550 7:22571276-22571298 CTCCAAATCATTCTTCTTTTAGG - Intronic
1021664796 7:22965912-22965934 CTCACTATAATACATATTTCTGG - Intronic
1021690446 7:23225627-23225649 CTCAATATAATACTTGTTCGTGG - Intergenic
1022156147 7:27663493-27663515 ATACATATACTACTACTTTCTGG - Intergenic
1022360430 7:29651339-29651361 CTCCATTTTATTCTGCTTTCAGG - Intergenic
1022394725 7:29976725-29976747 CTCCTTATCAAACTTCTTTCAGG + Intronic
1022984466 7:35637357-35637379 CTTCATAAAATACTGCTTTCAGG + Intronic
1023472854 7:40543704-40543726 CTCCAAGTAAGAATTCTTTCTGG - Intronic
1026083697 7:67244796-67244818 CTCCCTTTAGTACTTCTTTTGGG - Intergenic
1027299070 7:76810479-76810501 CTTCATATGTTATTTCTTTCTGG - Intergenic
1028429185 7:90727388-90727410 TTCCCTCTAACACTTCTTTCTGG - Intronic
1029331675 7:99861503-99861525 CTCCAGAGAATAATTCATTCTGG - Intronic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1032280338 7:130494769-130494791 CCCCATTTAGTACTCCTTTCTGG - Intronic
1035493963 7:159305694-159305716 TTCCATATAAGATTTTTTTCTGG + Intergenic
1035794725 8:2344310-2344332 CTCCATCCTTTACTTCTTTCAGG - Intergenic
1038101738 8:24385414-24385436 CTCCATTTTATCCTTCTTTTGGG - Intronic
1038991486 8:32873023-32873045 GTCAATAAAATACTTCTTCCAGG - Intergenic
1040755437 8:50768234-50768256 CTCCCATTAATACTACTTTCTGG + Intronic
1041747395 8:61223329-61223351 CTACATTTAGTGCTTCTTTCAGG + Intronic
1043280082 8:78453174-78453196 CTCCATCTAAAACTTATTTATGG - Intergenic
1044127908 8:88481177-88481199 CTATATTTAGTACTTCTTTCTGG - Intergenic
1044257000 8:90075593-90075615 CTTCATTTAATACAGCTTTCTGG + Intronic
1045216044 8:100149414-100149436 TTCCATCTAATAGTTCTTACAGG + Intergenic
1045798348 8:106072830-106072852 CTCCATCTAAAATGTCTTTCTGG + Intergenic
1046240829 8:111489166-111489188 TTCAATATACTACTTCTTTTTGG + Intergenic
1046611330 8:116428794-116428816 CTCCTAATAATGCTTCTTTTTGG - Intergenic
1046827449 8:118706900-118706922 CTCCATACAGTTCTTCTTCCAGG + Intergenic
1047565158 8:126036181-126036203 CTCCATTTTATGGTTCTTTCTGG + Intergenic
1048346833 8:133582245-133582267 ATCCATCTCTTACTTCTTTCTGG + Intergenic
1048362070 8:133706089-133706111 CTACATAGAATACTTCTCTGGGG - Intergenic
1048858166 8:138701360-138701382 GTCCATTTACTGCTTCTTTCGGG - Intronic
1051151912 9:14089421-14089443 CTCCATATGATACTTTTTAAAGG - Intronic
1052122259 9:24731860-24731882 CTGCATAAAATACTGCTTTCAGG + Intergenic
1052459362 9:28742435-28742457 CTCCCTAAACTACTTTTTTCTGG + Intergenic
1055433935 9:76273156-76273178 CTCCCTCTAATTCATCTTTCAGG + Intronic
1058100728 9:100915462-100915484 CTCCCCCTCATACTTCTTTCTGG + Intergenic
1186809415 X:13173579-13173601 CTGGATATAATACTTCCTTATGG - Intergenic
1187819977 X:23277096-23277118 CTCCAAATAACATTTCTTTGAGG - Intergenic
1188441208 X:30216467-30216489 CTCTATATGGCACTTCTTTCTGG - Intronic
1190463461 X:50702128-50702150 CTCAATATAATTCTTCATTAGGG + Intronic
1193495747 X:82210093-82210115 CTATATATAATACTTTATTCTGG - Intergenic
1193595230 X:83437691-83437713 CTACATTTAGTGCTTCTTTCAGG + Intergenic
1194190192 X:90825558-90825580 CTCCATTTAATATTTCTTGCAGG + Intergenic
1194896665 X:99450351-99450373 CTCCCTGTAATATTTCTTTAGGG + Intergenic
1194986450 X:100494930-100494952 CTCCAAATAATGCTTGCTTCAGG + Intergenic
1195515360 X:105768473-105768495 CTTCATATAATACTTATAGCAGG - Intergenic
1195776531 X:108412218-108412240 TTACATATAATACTTGTTTTTGG - Intronic
1196371907 X:114988592-114988614 CTCCATGGAATACTTATGTCTGG + Intergenic
1199819213 X:151428042-151428064 CTCCTTATAATGCTGCTTTGAGG + Intergenic
1200286043 X:154823121-154823143 CTCCATATAATAATTATTTAAGG - Intergenic
1200536789 Y:4407656-4407678 CTCCATTTAATATTTCTTGCAGG + Intergenic