ID: 949737330

View in Genome Browser
Species Human (GRCh38)
Location 3:7188612-7188634
Sequence AGGATCTACTTGAGTGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949737327_949737330 25 Left 949737327 3:7188564-7188586 CCTGCAGGTGAAAGATGTAAGGA 0: 1
1: 0
2: 1
3: 24
4: 285
Right 949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG 0: 1
1: 0
2: 3
3: 28
4: 261
949737325_949737330 26 Left 949737325 3:7188563-7188585 CCCTGCAGGTGAAAGATGTAAGG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG 0: 1
1: 0
2: 3
3: 28
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949737330 Original CRISPR AGGATCTACTTGAGTGTATA AGG Intronic
903598477 1:24515676-24515698 AGGACATACTTGAGTGCCTACGG + Intronic
906882707 1:49609744-49609766 AGGGCCTACTTGAGGGTATGTGG - Intronic
907364748 1:53948880-53948902 AGGATCTTCCTGAGTCTATGAGG - Intronic
907381928 1:54098017-54098039 CGGGTCTATTTGATTGTATATGG + Exonic
908163253 1:61432481-61432503 AGGAGCTGCCTGAGTGTAGAAGG + Intronic
909494594 1:76264418-76264440 AGAATCTCCTTAAGTGCATATGG - Intronic
910148253 1:84108312-84108334 AGGATATACTTGAGGGTGGAAGG + Intronic
910313299 1:85853124-85853146 AGGACCTACTTGAGAGTGAAGGG - Intronic
911543929 1:99192703-99192725 AGGGTCTACTTGAGGGTAGAGGG + Intergenic
913356148 1:117924285-117924307 AGGACCTACTTGAGGGTGAAAGG - Intronic
913931793 1:124977106-124977128 AGAATCTACTTGAGGATATTTGG - Intergenic
913933060 1:125003909-125003931 AGGATCTGCTTGAGGATATTTGG + Intergenic
915649699 1:157300806-157300828 GGGGCCTACTTGAGTGTAAAGGG + Intergenic
916285780 1:163103417-163103439 AGGACCTACTTGAGGGTAGAGGG - Intergenic
916708377 1:167377822-167377844 AGGGCCTACTTGAGGGTAGAGGG - Intronic
916967307 1:169963104-169963126 AGGACCTACTTAAGGGTAGAGGG - Intronic
917965692 1:180177151-180177173 AGGATGTACGTGTGTGTGTAAGG - Intronic
918135690 1:181672223-181672245 GGGGTCTACTTGAGTGTGGAGGG + Intronic
918222811 1:182451353-182451375 AGGATATACGTGATGGTATAGGG + Intronic
919565549 1:199180897-199180919 AGGATAAGCTTGAGTGAATATGG - Intergenic
922550281 1:226489528-226489550 AGGATCTACCTGGGTGTGCAGGG - Intergenic
923915542 1:238499679-238499701 GGGATCTACTTGAGGGTGGAGGG + Intergenic
924128963 1:240885735-240885757 GGGATCTACTTGAGAGTGGAGGG + Intronic
924900451 1:248392576-248392598 AGTTTCTACTTAAGTGAATAGGG + Intergenic
1068086581 10:52381097-52381119 AGGGTCTACTTGAGGGTAGAAGG - Intergenic
1068176397 10:53465178-53465200 AGGATCTACTAGAAAGTAGATGG - Intergenic
1070159154 10:73855145-73855167 AGGACTTGATTGAGTGTATATGG - Intronic
1074239848 10:111627255-111627277 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1077768349 11:5186950-5186972 AGGCTCCACTTGAGAGAATAAGG - Intergenic
1079277217 11:19052534-19052556 AGGATCTACTCGAGGGCATTGGG + Intergenic
1079446427 11:20560736-20560758 AGTATTTACTTGATTGTTTAGGG - Intergenic
1080500785 11:32869119-32869141 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1085223227 11:74894249-74894271 AGGATCTACTTGAGGGTAGAGGG + Intronic
1086542420 11:87929149-87929171 AGGATAGACTTGAATGAATAGGG - Intergenic
1086664189 11:89459285-89459307 GGGGTCTACTTGAGGGTAGAGGG + Intronic
1087978087 11:104575397-104575419 GGGGTCTACTTGAGGGTAGAGGG + Intergenic
1090408594 11:126492404-126492426 AGGAAGTACTTGAGTGGACAGGG - Intronic
1091069530 11:132550149-132550171 AGGAGCCATTTGTGTGTATAAGG - Intronic
1091496544 12:977960-977982 ATGATCAAGTTGAGTGAATATGG + Intronic
1094722590 12:33079590-33079612 AGGGTCTACTTGAGGGTAGAGGG - Intergenic
1095032738 12:37314972-37314994 AGGATCTACTTGCGGATATTCGG + Intergenic
1095056623 12:37613260-37613282 AGGATCTGCTTGTGGGTATTTGG + Intergenic
1095680086 12:44964061-44964083 AGGGCCTACTTGAGGGTAGAAGG + Intergenic
1096738190 12:53672677-53672699 AGGATATAGTTTAGTGAATAAGG - Intronic
1096929523 12:55191166-55191188 AGGATCTATCTGAGGGTAGAGGG - Intergenic
1098989911 12:77054062-77054084 AGGGCCTACTTGAGGGTAGAGGG + Intronic
1099662850 12:85587535-85587557 GGGGTCTACTTGAGAGTAGAGGG + Intergenic
1100675068 12:96857293-96857315 AGGGTCTACTTGAGGGTAGAAGG - Intronic
1101423735 12:104570374-104570396 AGGATCTGCTGGAGTGTGGAAGG - Intronic
1101806749 12:108070674-108070696 GGGATCTACTTGAGGGTGGATGG - Intergenic
1106363584 13:29055522-29055544 AGGGCCTACTTGAGGGTAGAAGG - Intronic
1106814921 13:33397072-33397094 AGGATCTCCTTGAGTCCATTGGG + Intergenic
1108161350 13:47643329-47643351 AGAAGCTACCTGAGTGTAAAGGG - Intergenic
1108972015 13:56388333-56388355 AGGATCGACTTGAGTGGGTAGGG - Intergenic
1109374823 13:61478614-61478636 AGGGCCTACTTGAGGGTAAAGGG - Intergenic
1109952700 13:69520973-69520995 AGGATCTAATGAAATGTATATGG - Intergenic
1110061019 13:71038211-71038233 AGGACCTACTTGAAGGTACAGGG + Intergenic
1110802709 13:79718292-79718314 AGAAACTACTTAAGTGTAGAGGG - Intergenic
1112865099 13:103885450-103885472 AGGACCTACTTGAGGGTGAAAGG + Intergenic
1114071616 14:19113814-19113836 AGTAACTCTTTGAGTGTATAAGG - Intergenic
1114090645 14:19286154-19286176 AGTAACTCTTTGAGTGTATAAGG + Intergenic
1115814496 14:37148277-37148299 AAGATGTCCTTGAGTTTATAAGG + Intronic
1116182575 14:41553869-41553891 AGGACCTACTTGAGTGTGGAGGG + Intergenic
1116816607 14:49590024-49590046 AGGGCCTACTTGAGGGTAGAGGG + Intronic
1117122482 14:52582952-52582974 AGGATCTGCTAGTCTGTATATGG + Intronic
1118247959 14:64130046-64130068 AGGATGTACTTGACAGTATGTGG + Exonic
1118528073 14:66668620-66668642 AGGGCCTACTTGAGGGTAGAAGG + Intronic
1123217853 14:106828784-106828806 AGGTCCTACTTGAGTGTGGAGGG + Intergenic
1123769663 15:23516096-23516118 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1124448082 15:29757313-29757335 AGGTTTCACTTGAGTGTAAAAGG - Intronic
1126227130 15:46284053-46284075 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
1127163639 15:56219517-56219539 AGGTCCTACTTGAGGGTAGAGGG - Intronic
1128369328 15:67028759-67028781 AGGGCCTACTTGAGAGTAAAGGG + Intergenic
1129585424 15:76858620-76858642 AGGGCCTACTTGAGGGTAGAGGG - Intronic
1130439449 15:83937497-83937519 AGGGTCTACTTGAGGGTGGAAGG + Intronic
1133613475 16:7454492-7454514 ATGATCAAGTTGAGTTTATAAGG + Intronic
1135128793 16:19834639-19834661 AGGATCTACATGAGTGTTTTGGG + Intronic
1135246932 16:20864971-20864993 GGGGTCTACTTGAGGGTAGAGGG + Intronic
1136678017 16:31931960-31931982 AGGACCTACTTGAGGGTGGAGGG + Intergenic
1138720974 16:59078644-59078666 GGGATCTACTTGAGGGCAGAGGG - Intergenic
1139154188 16:64421302-64421324 AGGGTCTACTTGAGGGTGTAGGG - Intergenic
1140572790 16:76128306-76128328 AGGACCTACTTGAGAGCAGAGGG - Intergenic
1141377731 16:83547454-83547476 AGGGCCTACTTGAGGGTAGATGG - Intronic
1149128190 17:53260891-53260913 AGGGCCTACTTGAGGGTAAAGGG + Intergenic
1150048470 17:61936153-61936175 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1155036377 18:22028334-22028356 AGTACCTACTGCAGTGTATAGGG + Intergenic
1155262510 18:24058149-24058171 AGGGTCTACTTGAGGGTGGAGGG + Intronic
1155873397 18:31054792-31054814 AGGATATAAGTCAGTGTATATGG + Intergenic
1157372480 18:47128549-47128571 GAGATGTACTTCAGTGTATATGG - Intronic
1158057023 18:53293625-53293647 AGGGCCTACTTGAAGGTATAGGG - Intronic
1160138881 18:76300997-76301019 AGGACCTGCTTGAGGGTAGAGGG + Intergenic
1163965835 19:20746449-20746471 AGGGTCTACTTGAGAGTAGAGGG - Intronic
1166025519 19:40080663-40080685 AGGGCCTACTTGAGAGTAGAGGG + Intronic
926548914 2:14277193-14277215 AGGACCTACTTGAGGGTGAATGG - Intergenic
927046623 2:19285623-19285645 GGGACCTACTTGAGGGTACAGGG + Intergenic
927381965 2:22489597-22489619 AGGATCTACTTGAGGGTAGAGGG + Intergenic
927906493 2:26862446-26862468 ATGATCTACTTGGGTCTATAGGG + Intronic
928372424 2:30750294-30750316 GGGATCTACTTGAGTGGGGAGGG + Intronic
928539053 2:32267175-32267197 AAGATGTACTTGAATGAATATGG - Intergenic
930325134 2:49906730-49906752 AGGATCTACTTGAGCCTGGAAGG + Intergenic
932024909 2:68123092-68123114 AAGATCAATTTGAGTGTGTAGGG + Intronic
933080885 2:77984042-77984064 GGGATTTACTTGAGTGTGGAGGG + Intergenic
933536118 2:83577146-83577168 AGGGTTTACCTTAGTGTATATGG - Intergenic
933844041 2:86310985-86311007 AGAATCTACTTCAGTCTAGAAGG + Intronic
935665964 2:105512979-105513001 AGGAACTACTTGAGGGTGGAGGG - Intergenic
937190198 2:120088422-120088444 GGGATCTACTTGAGTGGGGAGGG + Intronic
938485868 2:131707376-131707398 AGTAACTCTTTGAGTGTATAAGG - Intergenic
939526147 2:143296819-143296841 GGGATCTACTTGAGGGGAGAGGG - Intronic
940038797 2:149337789-149337811 GGGGTCTACTTGAGGGTAAAGGG - Intronic
940583397 2:155610492-155610514 AGAATGTACTTGAGTGGTTAAGG - Intergenic
940831682 2:158473641-158473663 TGGGTCTACTTGAGGGTAGAGGG + Intronic
942917580 2:181330195-181330217 GGGATCTACTTGAGGGTGAAGGG + Intergenic
943240135 2:185373518-185373540 TGGATATAATTGAGTGTATTAGG - Intergenic
946520869 2:220463545-220463567 AAGATCTACTTGAGTCTTGAGGG + Intergenic
947438441 2:230094249-230094271 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1169961870 20:11169061-11169083 TGGTACTACTAGAGTGTATAGGG + Intergenic
1170139623 20:13112521-13112543 AGGATCCACTTGTATGTATAAGG + Intronic
1170521196 20:17187314-17187336 TGGATCTACTTGAGGGTGGAGGG + Intergenic
1174486550 20:50865117-50865139 AAGATATACTTGTGTGTCTATGG + Intronic
1174936127 20:54871022-54871044 AGGGTCTACTTGAGTGGGGAGGG + Intergenic
1175232931 20:57486054-57486076 AGGCTCTTCTTGAATGTAAATGG - Intergenic
1176865636 21:14052967-14052989 AGGATCTACATGAGGGTGGAGGG - Intergenic
1178312082 21:31537988-31538010 AGGATGTACTTGATTGTATTTGG - Intronic
1178489520 21:33040234-33040256 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1179279476 21:39922265-39922287 AAAATCTACTTGAGTATATGAGG + Intronic
1180490060 22:15836145-15836167 AGTAACTCTTTGAGTGTATAAGG - Intergenic
1181901993 22:26163764-26163786 TGGATTTACTTGTCTGTATAAGG - Intergenic
1182176804 22:28298535-28298557 AGGATTTACTTGAGTCTAGAAGG - Intronic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
949761350 3:7474337-7474359 AGGGTCTACTTGAGAGGACAGGG - Intronic
950923521 3:16717669-16717691 AGGAACTCCTTGGGTGCATAGGG - Intergenic
951764585 3:26183532-26183554 AGGAGCAACATGAGTTTATATGG + Intergenic
955538003 3:59944679-59944701 AGGACATATTTGAGTGTAGAAGG - Intronic
955886245 3:63601499-63601521 AGGGTCTACTTGAGAGTGGAGGG - Intronic
956350759 3:68333464-68333486 GGGACCTACTTGAGTGTAGAGGG + Intronic
957535703 3:81500943-81500965 AGGGCCTACTTGAGGGTAGAAGG + Intronic
957901356 3:86497569-86497591 GGGGTCTACTTGAGGGTAGAGGG + Intergenic
958849935 3:99312457-99312479 GGGGTCTACTTGAGGATATAGGG + Intergenic
959310802 3:104734401-104734423 AGGACCTACTTGAGGGTGGAGGG - Intergenic
964177463 3:153841456-153841478 GGGATCTACTTGAGGGTGGAGGG - Intergenic
964366335 3:155954419-155954441 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
964687693 3:159415451-159415473 AGGGTGTACTTGAGGGTAGAGGG - Intronic
965065824 3:163847355-163847377 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
965464585 3:169012118-169012140 AGGACCTACTTGAGGGTGTAGGG - Intergenic
966651845 3:182310222-182310244 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
966818347 3:183906787-183906809 AGGGTCTACCTGAGGGTAGAGGG + Intergenic
967374314 3:188783543-188783565 GGGATCTACTTGAGGGTGGAGGG + Intronic
970012727 4:11477961-11477983 AGGGTCTACTTGAGAGTGGATGG + Intergenic
970753297 4:19393076-19393098 AGGCTCTAATTGATTTTATATGG + Intergenic
970795901 4:19913077-19913099 GGGATCGTCTTTAGTGTATATGG + Intergenic
971521151 4:27552069-27552091 GGGATCTACTTGAGGGTGGAGGG - Intergenic
972143380 4:35989670-35989692 AGGGTCTACTTGAGGGTGAAGGG + Intronic
972175576 4:36401821-36401843 AGGGACTACTTGAGTGTGGAGGG - Intergenic
972340157 4:38145593-38145615 AGGTTCTAAATGTGTGTATAGGG + Intergenic
972722024 4:41709253-41709275 AGGACATATTTTAGTGTATATGG + Intergenic
973528927 4:51814964-51814986 AGGATCTACTTGAGGATATTTGG - Intergenic
973761045 4:54116085-54116107 AGGACCTACCTGAGGGTAGAGGG - Intronic
973977294 4:56275118-56275140 GGAATCTACTTGAGTGTGGAGGG + Intronic
974598587 4:64045968-64045990 AGGGCCTACTTGAGTGTAGAGGG + Intergenic
976061424 4:81132530-81132552 AGGACATTCTTCAGTGTATAAGG - Intronic
976481326 4:85549762-85549784 AGGGCCTACTTGAGGGTAGAGGG - Intronic
977403485 4:96564648-96564670 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
977482845 4:97600076-97600098 AGGACCTACTTGAGGGTGGAAGG + Intronic
977489423 4:97693287-97693309 AGTATCTGCTTGTGAGTATAAGG + Intronic
977552380 4:98456193-98456215 GGGGTCTACTTGAGAGTAGAGGG + Intergenic
978252987 4:106655606-106655628 AGGGCCTACTTGAGAGTAGAGGG + Intergenic
978295122 4:107196062-107196084 AGGATCTGCTTTAGGGTATTAGG - Intronic
983155638 4:164344212-164344234 AGGACCTACTTGAGGGTGGAGGG + Intronic
983486712 4:168340800-168340822 AGGGCCTACTTGAGTGTAGAGGG - Intergenic
984516633 4:180749494-180749516 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
986453746 5:7893783-7893805 GGGATATACTTGAGAGGATAAGG + Intronic
986467379 5:8039241-8039263 AGGGGCCACTTGAGGGTATAGGG - Intergenic
987383471 5:17307472-17307494 GGGGTCTACTTGAGTGTGAAGGG - Intergenic
988004068 5:25385077-25385099 GGGATCTACTTGAGGGTAGAGGG - Intergenic
988163267 5:27548958-27548980 AGGATCTACTTGAGTGTGAAGGG + Intergenic
988979752 5:36555053-36555075 GGGATCTACTTGAGGGTGTTGGG - Intergenic
989491541 5:42060922-42060944 GGGATCTACTTGAGCGTAGAGGG + Intergenic
989882484 5:46812764-46812786 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989882539 5:46813959-46813981 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989882752 5:46818048-46818070 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989883827 5:46839189-46839211 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989884093 5:46844474-46844496 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989884353 5:46849755-46849777 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989884628 5:46855210-46855232 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989885161 5:46865606-46865628 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989885660 5:46875322-46875344 AGAATCTGCTTGCGTGTATTAGG + Intergenic
989886217 5:46886232-46886254 AGAATCTGCTTGCGTGTATTAGG + Intergenic
989886936 5:46900206-46900228 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989887181 5:46904980-46905002 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989887457 5:46910265-46910287 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989887721 5:46915549-46915571 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989888122 5:46923562-46923584 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989888609 5:46933108-46933130 AGAATCTGCTTGCGTGTATTAGG + Intergenic
989889109 5:46942821-46942843 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989889385 5:46948276-46948298 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989891690 5:46993788-46993810 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989892549 5:47010492-47010514 AGAATCTGCTTGCGTGTATTAGG + Intergenic
989892955 5:47018503-47018525 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989893227 5:47023958-47023980 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989893642 5:47031971-47031993 AGAATCTGCTTGCGTGTATTTGG + Intergenic
989895361 5:47064894-47064916 AGAATCTGCTTGCGTGTATTTGG - Intergenic
989895569 5:47068984-47069006 AGAATCTGCTTGCGTGTATTTGG - Intergenic
990010227 5:50988864-50988886 AGAATCTACTTGGATGAATAAGG - Intergenic
992309348 5:75479450-75479472 GGGGTCTACTTGAGGGTAGAGGG - Intronic
993451686 5:88078864-88078886 AGGGTCTAGTTGAGGGTAGATGG + Intergenic
993801423 5:92347626-92347648 GGGATCTACTTGAGGGTGGAGGG - Intergenic
994242990 5:97446104-97446126 AGGTTCTACTTGAGGGTGGAGGG + Intergenic
994312792 5:98295278-98295300 AGGATTTACATGAATGTATATGG - Intergenic
995170625 5:109107485-109107507 GGGGTCTACTTGAGGGTAGAGGG - Intronic
998055037 5:139067460-139067482 AGGAAATACTTGAATGTTTAAGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999071056 5:148744587-148744609 GGGACCTACTTGAGGGTAGAGGG + Intergenic
999598245 5:153229891-153229913 AGGATCTACTTGAGGATGAAGGG - Intergenic
999761718 5:154706546-154706568 AGGATTTACTTGAGAGTGGAGGG + Intergenic
1000678441 5:164152919-164152941 AGGATCTACTTGAGGGTGGAGGG + Intergenic
1000787867 5:165568966-165568988 AGGATCTACTTGAATATATTGGG - Intergenic
1001569382 5:172720093-172720115 AGGAACTACTGGAGTGAAGAAGG - Intergenic
1001767975 5:174269410-174269432 AGGACCTACTTGAGGGTAGAAGG + Intergenic
1002822957 6:745425-745447 AGGGCCTACTTGAGGGTAAAGGG + Intergenic
1004034079 6:11904933-11904955 GGGATCTACTTGAGGGTGGAGGG - Intergenic
1004059368 6:12177152-12177174 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1004533874 6:16480577-16480599 AGGATGTTCTTGAGTCTATCAGG - Intronic
1005102075 6:22182101-22182123 GGGGTCTACTTGAGGGTAGAGGG - Intergenic
1005909681 6:30297542-30297564 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1007216245 6:40241519-40241541 TGGATCTACTTGAGGGTGGAGGG + Intergenic
1008449065 6:51628230-51628252 AGGGTCTACTTGAGTGGGGAAGG - Intronic
1008736666 6:54552945-54552967 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1009467238 6:63986766-63986788 GGGGTCTACTTGAGGGTAAAGGG + Intronic
1010899419 6:81407877-81407899 GGGATCTACTTGAGGGTGGAAGG - Intergenic
1011257031 6:85433002-85433024 AGGGTCTACTTGAGGGTGGAAGG - Intergenic
1012586520 6:100929882-100929904 AGGACCTACTTGAGGGTACGGGG - Intergenic
1012834554 6:104248828-104248850 AGAGTCTACTTGAGTGTGGAGGG + Intergenic
1014901855 6:126975516-126975538 GGAATCTAATTGAGTGTAGAAGG - Intergenic
1015102276 6:129495557-129495579 AGGTTCTGCTTGATTGAATATGG - Intronic
1015170641 6:130248734-130248756 AGGCTCTCCTTGAGGGTAGAAGG + Intronic
1015769435 6:136753803-136753825 AGGATGCACTTGAGGGTAGATGG + Intronic
1016474234 6:144409027-144409049 AGGAACCACTTGAATGTGTATGG - Intronic
1017929860 6:158942367-158942389 AGGGCCTACTTGAGGGTAGAAGG - Intergenic
1020651004 7:10876126-10876148 AGGGACTACTTGAGGGTAGAGGG - Intergenic
1021426188 7:20502313-20502335 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1023457147 7:40352464-40352486 AGGGCCTACTTGAGAGTAGAGGG - Intronic
1026046800 7:66911349-66911371 AGGATCTACTTGAATTTGGAAGG + Intergenic
1027547319 7:79544359-79544381 AGGATATCCTTGAGTATAAAAGG + Intergenic
1027754133 7:82189006-82189028 GGGACCTACTTGAGTGTAGAGGG + Intronic
1028143967 7:87301118-87301140 GGGGCCTACTTGAGTGTAGAGGG + Intergenic
1029334950 7:99890708-99890730 AGGGACTACTTGAGGGTAGAGGG + Exonic
1030711151 7:112750931-112750953 GGGACCTACTTGAGGGTAGAGGG + Intergenic
1032361667 7:131261977-131261999 AGGACCTACTGGAGTGTGGAGGG + Intronic
1033877336 7:145838575-145838597 AGGGCCTACTTGAGGGTGTAAGG + Intergenic
1037177078 8:15960543-15960565 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1037373024 8:18200523-18200545 GGGATCTACTTAAGGGTAAAGGG + Intronic
1039335001 8:36579100-36579122 AGGGGCTACTTGAGGGTAAAGGG + Intergenic
1039383789 8:37112112-37112134 AGGTCCTACTTGAGGGTAAATGG + Intergenic
1041302391 8:56426376-56426398 AGGGCCTACTTGAGTGTGAAGGG - Intergenic
1041715760 8:60930635-60930657 AGGGCCTACTTGAGGGTAAAGGG - Intergenic
1042141076 8:65679298-65679320 AGGATCTATTAAAATGTATAAGG + Intronic
1042143030 8:65698691-65698713 AGGGCCTACTTGAGAGTAGAAGG - Intronic
1043168570 8:76935220-76935242 AGTAGTTACCTGAGTGTATATGG + Intergenic
1043249947 8:78059297-78059319 AGGATGTATTTAAGTGTATTTGG + Intergenic
1043848989 8:85194371-85194393 AGAATCTACTAGAATGTACATGG - Intronic
1044960848 8:97529289-97529311 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1045592902 8:103618309-103618331 AGGATCTACTTGAATGGGGAGGG + Intronic
1045691752 8:104766463-104766485 AGGGTCTACTGGAGGGTAGAGGG + Intronic
1046638488 8:116699537-116699559 AGGAACTACTAGAGTGGGTAGGG + Intronic
1048668716 8:136693432-136693454 AGGATGTACTTGAGGATAGAGGG - Intergenic
1049652673 8:143780477-143780499 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1050764738 9:9118273-9118295 AGGATCTACCTGAGAATACATGG + Intronic
1053115092 9:35493138-35493160 AGGGTCTTCTTGAGGGTAGAAGG - Intronic
1055728865 9:79260454-79260476 AGGATCATCATGAGTGTATGTGG + Intergenic
1055825025 9:80313393-80313415 GGGGTCTACTTGAGTGTGAAGGG - Intergenic
1058930446 9:109713966-109713988 AGGAGAAACTTGAGGGTATATGG + Intronic
1059036583 9:110760549-110760571 GGGATCTACCTGAGGGTAGAGGG + Intronic
1059633080 9:116145683-116145705 AGGGCCTACTTGAGGGTGTATGG + Intergenic
1185670412 X:1805046-1805068 GGGGTCTACTTGAGGGTAAAAGG - Intergenic
1185930557 X:4198397-4198419 AGGGTCTACTTGAGGGTGAAGGG - Intergenic
1187600286 X:20821733-20821755 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1188849761 X:35117107-35117129 ACTATATCCTTGAGTGTATATGG + Intergenic
1188994983 X:36873071-36873093 AGAGTCTACTTGAGTGTGAAGGG + Intergenic
1190133322 X:47771017-47771039 GGGGTCTACTTGAGGGTGTAGGG + Intergenic
1190447937 X:50549247-50549269 GGGGTCTACTTGAGGGTAGAGGG - Intergenic
1191219286 X:57969683-57969705 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1191817321 X:65260404-65260426 AGGGACTACTTGAGGGTGTAGGG + Intergenic
1191926420 X:66315743-66315765 AGGGGCTACTTGAGAGTAGAGGG + Intergenic
1193096989 X:77561164-77561186 AGGACATACTTGAAGGTATATGG + Intronic
1193570437 X:83134952-83134974 TGGCTCTACTTGAGTGTGGAGGG + Intergenic
1196472330 X:116042571-116042593 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1196933223 X:120702720-120702742 GGGGTCTACTTGAGTGGAAAGGG + Intergenic
1197367235 X:125579157-125579179 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1198063205 X:133068240-133068262 AGGGCCTACTTGAGGGTAGAGGG + Intronic
1200607532 Y:5285060-5285082 AGGATCTACTTCAGGGTGGAGGG - Intronic
1200783060 Y:7234231-7234253 AGGGCCTACTTGAGGGTTTAGGG + Intergenic
1201384303 Y:13421752-13421774 GGGATCTACTTGAGAGTGGAGGG + Intronic
1201967768 Y:19756793-19756815 AGGATCTACTTCAGGGTGGAGGG - Intergenic