ID: 949737447

View in Genome Browser
Species Human (GRCh38)
Location 3:7190240-7190262
Sequence CATGGTGATCAGAGTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949737443_949737447 29 Left 949737443 3:7190188-7190210 CCTCTCTCTGTGCTTTCTTACTG 0: 1
1: 0
2: 3
3: 59
4: 567
Right 949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949737447 Original CRISPR CATGGTGATCAGAGTAAGGC AGG Intronic
902824727 1:18965178-18965200 CATGATGATAAGAATGAGGCAGG - Intergenic
903217349 1:21850563-21850585 CTTGGGGGTCAGAGTGAGGCAGG - Intronic
903439216 1:23374861-23374883 AATGATGCTCAGAGTCAGGCAGG + Intergenic
904034719 1:27552345-27552367 CATGGTGGTTTGAGAAAGGCTGG - Intronic
906858182 1:49330909-49330931 CATGGAGAACAGAGGAAAGCAGG + Intronic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
912843454 1:113059385-113059407 GCTGGTGAACAGAGTGAGGCTGG + Intergenic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
915091550 1:153429659-153429681 GATGGTGCTCAGATTTAGGCTGG + Intergenic
915900941 1:159846375-159846397 CCTGGTGAGCAGAGTCAGCCAGG - Intronic
915920863 1:159974206-159974228 CATGCTGACCAGAGAAGGGCAGG + Intergenic
916155319 1:161839688-161839710 AATGGTGATCACTGTAAGGCAGG + Intronic
917616632 1:176752465-176752487 CATGGTTAGCAAAGCAAGGCAGG - Intronic
917713735 1:177712639-177712661 CCTGGTGATCCCAGTGAGGCTGG - Intergenic
919769518 1:201148331-201148353 CATGCTGATCTGAGGAAGGCTGG - Intronic
920226528 1:204443087-204443109 CATGGTGAACAAAATATGGCTGG + Intronic
922243335 1:223771303-223771325 CCTTGTGATCAGAGTCTGGCTGG - Intronic
923017229 1:230136335-230136357 CAGGGTTATCAGAGGATGGCTGG - Intronic
1065461300 10:25967900-25967922 CATAGTTATCAAAATAAGGCTGG + Intronic
1067836444 10:49644497-49644519 GATGCTGATCAGACTGAGGCAGG + Intronic
1071858015 10:89645181-89645203 CCTGGGGATCAGGGGAAGGCGGG - Exonic
1076302786 10:129440682-129440704 CATGTTGATCAGAATAACTCTGG + Intergenic
1076676033 10:132148255-132148277 CATGGAGCTCAGTGTCAGGCAGG + Intronic
1078135369 11:8647731-8647753 CAGGATGATCAGAGTGAGTCTGG - Intronic
1078625550 11:12953690-12953712 TTTGGTTATCAGAGTAATGCTGG - Intergenic
1080303361 11:30809987-30810009 CATGGTGATCAAACTATGTCTGG + Intergenic
1080319720 11:30992572-30992594 CATGGTGATGGGAGAAAGCCAGG - Intronic
1082234763 11:49810817-49810839 CAAGGTGATCAGAACAATGCTGG + Intergenic
1082608468 11:55271509-55271531 CAAGGTGATCAGAACAATGCTGG + Intergenic
1083734736 11:64673033-64673055 TTTGGTGCTCAGAGTAAGCCTGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1095468138 12:42509472-42509494 AAGGGTGAGCAGAATAAGGCAGG - Intronic
1101127146 12:101647909-101647931 CATGGTGATAACAGTAAGTGAGG - Intronic
1102262992 12:111456386-111456408 CAGGGTGGTAAGAGCAAGGCTGG + Intronic
1102478603 12:113205124-113205146 CATGGAGTTCACAGTAAGGAAGG - Intronic
1102678106 12:114672171-114672193 CATGGTGTTCAGATTGAGGAAGG + Exonic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1109304201 13:60620620-60620642 CATGCTGATCATAAAAAGGCTGG - Intergenic
1110873155 13:80476302-80476324 CATGATAATCAAAGTGAGGCAGG + Intergenic
1116777364 14:49196230-49196252 CACAATGATCAGTGTAAGGCAGG + Intergenic
1117117668 14:52533245-52533267 GATGGTGATCAGACTAGAGCTGG + Intronic
1118922178 14:70159624-70159646 CAAGGTGAGCAAAGCAAGGCAGG - Intronic
1120408729 14:84122894-84122916 AATGCAGATCAGAGAAAGGCTGG - Intergenic
1122277789 14:100604063-100604085 CAAGGTGATCAGAGCAAATCAGG - Intergenic
1124512667 15:30340308-30340330 AAAGGTGTTCAGAGGAAGGCGGG + Intergenic
1124730248 15:32190442-32190464 AAAGGTGTTCAGAGGAAGGCGGG - Intergenic
1127961857 15:63896032-63896054 GGCGGTGATCAGAGGAAGGCAGG - Intergenic
1132028848 15:98424356-98424378 CCTGGTGGTTAGAATAAGGCAGG - Intergenic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1137625916 16:49908493-49908515 CCTGGTGATAAGAGAAAAGCAGG + Intergenic
1137718840 16:50615468-50615490 CATGCTGCTCAGAGGAAGGGAGG + Intronic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1141092507 16:81139777-81139799 CATGCTGATCAGAGTAGAGTGGG - Intergenic
1144555572 17:16279844-16279866 CAAGATGGTCAGAGTCAGGCAGG + Intronic
1145770833 17:27491899-27491921 GATGGTGAGCAGAGTATAGCAGG - Intronic
1146552650 17:33795060-33795082 CATGGTAATCAGAGCAAAGCTGG + Intronic
1148084055 17:44983771-44983793 CATGGTGCTCAGGCTAAGGGAGG - Intergenic
1149507566 17:57207450-57207472 CTTGCAGATCAGAGTCAGGCAGG - Intergenic
1150329134 17:64280987-64281009 CATTGTGGTTAGAGAAAGGCAGG + Intergenic
1150714883 17:67563705-67563727 CATGGTCTTTAGAGTAGGGCAGG - Intronic
1150944953 17:69734907-69734929 CAGGGTAATCTGAGTAAGTCTGG - Intergenic
1151943356 17:77306209-77306231 CATGGTGATCAGATACAGGGAGG + Intronic
1152496552 17:80676799-80676821 CATGGAGAACAGAGTCAGGGAGG + Intronic
1152498913 17:80695153-80695175 CATGGTGGTAAGAGTGAGGCGGG + Intronic
1153776936 18:8462747-8462769 CATTGTGAAAAGAGAAAGGCAGG - Intergenic
1161076298 19:2287399-2287421 CATGGTAAGCAGAGTCAGACAGG + Intronic
1163020121 19:14477233-14477255 GAGGGTGATCAGGGAAAGGCGGG - Intergenic
1165062790 19:33212939-33212961 CATGGAGATGACAGCAAGGCTGG + Exonic
925641600 2:5990586-5990608 CCGGGTGGTCAGAGTGAGGCTGG - Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926188915 2:10712631-10712653 CATGGAGATCAGAGTGAGCAGGG + Intergenic
927785886 2:25974613-25974635 CATGGGCATCAGAGTCAGCCAGG - Intronic
930984699 2:57570874-57570896 CATGGTGAGTATATTAAGGCAGG - Intergenic
932121323 2:69103153-69103175 CTTGGTAAGCAGAGCAAGGCTGG + Intronic
932422939 2:71612074-71612096 CCTAGTGGCCAGAGTAAGGCAGG + Intronic
934653939 2:96107752-96107774 CATGGTGTCTATAGTAAGGCTGG - Intergenic
936097319 2:109540687-109540709 CATGGTGATGTGCCTAAGGCAGG + Intergenic
937165533 2:119812322-119812344 CTTGGTGAACAGAGAAATGCTGG - Intronic
939583476 2:143979049-143979071 CCTGGTTGTCAGAGTAAAGCAGG - Intronic
940124431 2:150309018-150309040 CATGGAGATCAAAGAAAAGCAGG + Intergenic
940169353 2:150810577-150810599 CATGGTGAAGAGGGTAAGACTGG - Intergenic
942569564 2:177300014-177300036 AATGGTGAGCAAAGTAAGCCAGG - Intronic
945016690 2:205525925-205525947 CATGAAAATCAGAGTAAGACTGG - Intronic
948318836 2:237052796-237052818 GATGGTGATCAGAGTAGGGAAGG + Intergenic
1172896316 20:38302858-38302880 CATGGTGATGAGAGGAGGGGCGG - Intronic
1173582537 20:44157788-44157810 CATGGTCTTCAGAGTTAAGCAGG - Intronic
1175844230 20:62050279-62050301 CATGGGGAGCAGAGCCAGGCCGG - Intronic
1176222586 20:63977118-63977140 CATAGTGGTCAGAGTACAGCCGG + Exonic
1176287296 21:5024849-5024871 CATGGAGAACAGAGGCAGGCAGG + Intronic
1179869885 21:44238626-44238648 CATGGAGAACAGAGGCAGGCAGG - Intronic
1181730459 22:24842599-24842621 CATGGGGATCAGAGCCTGGCAGG + Intronic
949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG + Intronic
951912889 3:27769754-27769776 GATGGTGATCAGAGACAGGAAGG - Intergenic
952492555 3:33886050-33886072 CATGGTGGTCACAGCAAGGATGG - Intergenic
952530491 3:34257528-34257550 CTTGGTGGTCAGAATGAGGCTGG + Intergenic
953549493 3:43890378-43890400 CATGGTGGTCAGGGAAAGGGTGG - Intergenic
954132261 3:48566776-48566798 AGTGGGGATCAGAGTCAGGCAGG + Intronic
955153409 3:56391531-56391553 CATGGTATTTAGAATAAGGCTGG - Intronic
957025615 3:75178362-75178384 CAAGGACATCAGAGTAAGGGAGG - Intergenic
957263871 3:77935401-77935423 CATGGAGAACAGAGTAAGAATGG + Intergenic
958968985 3:100590411-100590433 GATGGTCCTCAGAATAAGGCAGG - Intergenic
959631430 3:108511373-108511395 CATGGTGATGTGAGTGAAGCTGG + Intronic
960544549 3:118898614-118898636 GATGATGATCAGAGGAAGGGTGG + Intergenic
962070893 3:132033497-132033519 AAAGGTGAGCAGAGTGAGGCGGG - Intronic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
963745691 3:149122903-149122925 CTTAGTCATCAGAGTAATGCTGG + Intergenic
963843003 3:150127181-150127203 CATGGTGCTGAGTGTAAGGTCGG + Intergenic
964572528 3:158124404-158124426 CATTGGTATCAGAGTAATGCTGG + Intronic
965820075 3:172676344-172676366 CATGGTGACAAGAAGAAGGCAGG - Intronic
967141885 3:186568434-186568456 GATGGTGATCATTGTATGGCTGG - Intronic
969485297 4:7469074-7469096 GATGGTGATTATAGTGAGGCTGG + Intronic
970067605 4:12116654-12116676 CATGGAGATCTGAGCAACGCAGG - Intergenic
970439930 4:16071891-16071913 CAGGGTGATCAGAGGAAGTTAGG - Intronic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
972351629 4:38241786-38241808 CATGTTGATCAGGGTCAGGCTGG - Intergenic
972918538 4:43908109-43908131 GATGGGGTTCAGAGAAAGGCAGG + Intergenic
973767053 4:54172364-54172386 CATGGGGCTCAGAGTAAGCTTGG - Intronic
974927329 4:68316394-68316416 CATGGTGCTGATAGTAAGGATGG + Exonic
975989349 4:80240975-80240997 TATGGGGATCAGAGAAAGGCAGG - Intergenic
981648270 4:147025019-147025041 CCTGCTGAACAGAGTAAGTCTGG + Intergenic
983412251 4:167416609-167416631 CATGGTGATGAGAAGAAGGCGGG - Intergenic
986479605 5:8173239-8173261 CATTGTGCTCAGTGCAAGGCGGG - Intergenic
990345596 5:54867821-54867843 CATGCTGATCAGAGTTTGGAAGG - Intergenic
997713200 5:136023347-136023369 CACGGGGAGCAGAGCAAGGCTGG + Intergenic
999743562 5:154574910-154574932 CATCCTGAACAGACTAAGGCAGG + Intergenic
1000297500 5:159924910-159924932 CATGGAGAGCACAGTAAGCCTGG - Intronic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1005729193 6:28680213-28680235 CATGGTGATGAGAGTTGGGGTGG - Intergenic
1005814239 6:29538067-29538089 CCTGATGATCAAAGTCAGGCTGG + Intergenic
1005819571 6:29586791-29586813 CATGGAGCTCAGAGGATGGCAGG - Intronic
1005994470 6:30922964-30922986 CATGGAGTTCAGGGTAAGCCTGG + Exonic
1006282884 6:33069442-33069464 AAAGGTGAGCAGAGTGAGGCTGG - Intronic
1007546253 6:42697107-42697129 CCTGGTGACCAGACCAAGGCAGG - Exonic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1011011560 6:82709624-82709646 CTTGGTTATCAGGGTAATGCGGG + Intergenic
1011057902 6:83225865-83225887 TATGGTGATTATAGAAAGGCAGG - Intronic
1015869246 6:137759565-137759587 ACTGTTGATCAGAGCAAGGCAGG + Intergenic
1017007176 6:150036439-150036461 CATGGTGAACACAGTGAGCCTGG - Intergenic
1017964282 6:159250655-159250677 CATGGTCCTGGGAGTAAGGCAGG - Intronic
1018015894 6:159712188-159712210 TATGGTGATCAGAGCAATGTGGG - Intronic
1022197917 7:28087223-28087245 CATGTTGATGACAGTAAGACAGG + Intronic
1022471637 7:30685116-30685138 CATGAGCAGCAGAGTAAGGCAGG + Intronic
1022640526 7:32178227-32178249 CATGGTGATCCTTCTAAGGCAGG - Intronic
1025770126 7:64496873-64496895 TATTTTGATCAGAGTAAGCCTGG + Intergenic
1028659863 7:93257977-93257999 CGTGGTGTTCTGAGTAATGCTGG + Intronic
1029383177 7:100226557-100226579 CATGGTGACCAGAGCTGGGCAGG - Intronic
1030688589 7:112510408-112510430 CATGGTGATGAGAGTAGTGAGGG + Intergenic
1033313381 7:140278742-140278764 CATGCTGATTAGATTAAGGTGGG - Intergenic
1034224180 7:149470074-149470096 CATGGTGCTCAGGGAAAGGCTGG + Intergenic
1038320244 8:26519126-26519148 CATGGAAATCAGGGTGAGGCTGG + Intronic
1038499932 8:28035430-28035452 CATAGTCATCTGAGTGAGGCTGG + Intronic
1042354485 8:67811377-67811399 CATGGTTATGAGAATAAGGAAGG + Intergenic
1043666154 8:82817038-82817060 CTTTGTTATCAGAGTAATGCTGG + Intergenic
1044288639 8:90441007-90441029 CATGGTGATCAGAGTCAGCTAGG - Intergenic
1044852426 8:96442104-96442126 CGTGATGAGCAGAGTCAGGCTGG + Intergenic
1045579704 8:103465396-103465418 TATGGTCCTCAGAATAAGGCTGG - Intergenic
1047732791 8:127739928-127739950 CATGGTGAGAGGAGTAAGGGTGG + Intronic
1049563630 8:143325867-143325889 CATGGAGATCACAGCACGGCAGG + Intronic
1049854900 8:144855292-144855314 AATGTTGATCATAGTAAGGAAGG - Intergenic
1050580605 9:7051387-7051409 CATGGTGATCAGACTCAGAGAGG + Intronic
1052956584 9:34257161-34257183 CATGGTTTTCAGAGTAAGAGTGG + Exonic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1056535906 9:87527445-87527467 CATGGTCATCCGTGTAAGGCCGG - Intronic
1056673661 9:88654360-88654382 CATGGAGCTCAGTTTAAGGCAGG + Intergenic
1056851215 9:90086165-90086187 CATGTTGATGAGGGTAAGCCAGG + Intergenic
1059344547 9:113619425-113619447 CCTGGGGATCAGAGCAGGGCAGG + Intergenic
1059624308 9:116044713-116044735 CAAGGTTATCTGAGTAAGGGTGG - Intergenic
1060057343 9:120426140-120426162 CATGGTTAACAGAGTGATGCAGG - Intronic
1061446255 9:130640006-130640028 CATGGTCATCACTGTAAGGGCGG + Intergenic
1061467197 9:130790879-130790901 TATGGTGATCAGACTCAGGGTGG + Intronic
1195610836 X:106864235-106864257 CATGGGGATCTGTGTAAGGCTGG - Intronic
1197275318 X:124472207-124472229 CAAGGGGCTCAGAGTTAGGCAGG + Intronic
1199713594 X:150490027-150490049 CATGGTGAGCATAGTAATGCAGG - Intronic
1202103695 Y:21339084-21339106 CATGGTTATCAGGGTATGTCTGG + Intergenic