ID: 949739031

View in Genome Browser
Species Human (GRCh38)
Location 3:7208642-7208664
Sequence GACTCTGTTGGGTCCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949739021_949739031 27 Left 949739021 3:7208592-7208614 CCCAGCACCAAGTATAATAAACA 0: 1
1: 0
2: 1
3: 19
4: 290
Right 949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 207
949739022_949739031 26 Left 949739022 3:7208593-7208615 CCAGCACCAAGTATAATAAACAC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 207
949739023_949739031 20 Left 949739023 3:7208599-7208621 CCAAGTATAATAAACACTAGCTG 0: 1
1: 1
2: 1
3: 16
4: 150
Right 949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949739031 Original CRISPR GACTCTGTTGGGTCCTGTGG GGG Intronic
902839499 1:19066157-19066179 GACTGTGCTGAGTCCTGGGGAGG - Intergenic
904246701 1:29193268-29193290 GACTGTTCTGTGTCCTGTGGTGG + Intronic
904471124 1:30736971-30736993 GTCTTTGTTGGGTTTTGTGGGGG + Intronic
907231547 1:53004042-53004064 GACTGTGATGGGTACTGTGATGG - Intronic
907319228 1:53592422-53592444 GAGTCTGTGGGTGCCTGTGGGGG - Intronic
909451521 1:75802872-75802894 GTCTCTGTAGAGTCCTGTAGTGG + Intronic
910312356 1:85838626-85838648 GTCTCTGTAGGGTCCAGTGGGGG - Exonic
911092222 1:94026723-94026745 GAATGTGGTGGGTCCTGAGGTGG - Intronic
912513331 1:110202725-110202747 GACTCTCTTGGGTGCTGGGTTGG + Intergenic
913202448 1:116506185-116506207 AACTCTGTAGAGTCCTGAGGTGG + Intergenic
915251468 1:154592177-154592199 GACACTGTTAAATCCTGTGGTGG - Intronic
915981868 1:160425404-160425426 AACTCTGGGGGGTCCTGAGGGGG + Exonic
918200735 1:182264176-182264198 CTCTCTGTGGGGTCCTGAGGTGG - Intergenic
918545906 1:185683660-185683682 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
918745647 1:188195260-188195282 GAAACTGTGGGGTCCTATGGGGG - Intergenic
918852575 1:189710829-189710851 GAATCTGGTGGATCCTGTGTTGG - Intergenic
919044909 1:192439031-192439053 GACTTTGTTTGTTCCTGTGATGG - Intergenic
924167220 1:241296636-241296658 TGCTCTGTTGGTTGCTGTGGTGG - Intronic
924259716 1:242216855-242216877 GACTCTGTTAGGTGCTGATGAGG + Intronic
1063195214 10:3735339-3735361 CAGACTGTTGTGTCCTGTGGTGG - Intergenic
1063580445 10:7301611-7301633 GTCTCTGGTTTGTCCTGTGGAGG - Intronic
1064883944 10:20088504-20088526 GACACTGCTGGGTACTGTTGAGG + Intronic
1070239276 10:74661929-74661951 TACTCTGTTAGATCCTCTGGGGG - Intronic
1070572998 10:77655642-77655664 GGCTCTTTTGGGTGTTGTGGAGG - Intergenic
1073299474 10:102462047-102462069 GCCTCTTCTGGGACCTGTGGGGG + Intronic
1074492466 10:113951306-113951328 GGCTTTGTTTGGTTCTGTGGTGG + Intergenic
1074849168 10:117425131-117425153 GACTCTGATTGGCCCTGTGTGGG - Intergenic
1075386586 10:122059727-122059749 GACACTTTTGGGTGGTGTGGAGG + Intronic
1075634637 10:124022245-124022267 GACTCTGTTCTGGCCTGTGGGGG - Intronic
1076451032 10:130557114-130557136 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1076508040 10:130991450-130991472 GACGCTGATGGGTCCCGTGGGGG - Intergenic
1076545118 10:131240059-131240081 GACTGTGCTGGTCCCTGTGGTGG + Intronic
1076996627 11:300183-300205 GAGCCTGTGGGCTCCTGTGGTGG + Intergenic
1077364602 11:2156474-2156496 GACACTCTTGGGGGCTGTGGGGG - Intronic
1082317971 11:50753186-50753208 GAGTGTTTTGAGTCCTGTGGTGG - Intergenic
1082434994 11:52724716-52724738 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082468570 11:53210937-53210959 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082472283 11:53264706-53264728 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082490790 11:53531481-53531503 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082494231 11:53580544-53580566 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082496171 11:53608608-53608630 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082509624 11:53803800-53803822 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1082541935 11:54270921-54270943 GAGGGTTTTGGGTCCTGTGGTGG + Intergenic
1085257616 11:75184866-75184888 GATTCTGCTGGGTGTTGTGGTGG - Intronic
1086541126 11:87914374-87914396 CACGCTGTAGGGCCCTGTGGAGG + Intergenic
1087676618 11:101169832-101169854 GACTTTGTTGGATGCTGGGGTGG + Intergenic
1089697955 11:120227403-120227425 GACTCTGCTAGGCCCTGTGGAGG + Intronic
1091187857 11:133662624-133662646 CACTGTGCTGGGTGCTGTGGTGG + Intergenic
1091193614 11:133714406-133714428 GTCTGTGCTGGGTGCTGTGGTGG - Intergenic
1091449813 12:565459-565481 AACTCTGGTGGGTGTTGTGGGGG - Intronic
1091485269 12:880739-880761 GAATCTCCTGGGTACTGTGGTGG - Exonic
1095961324 12:47835963-47835985 GAGGCTGTTGAGTCCTGAGGAGG + Intergenic
1096361501 12:50991888-50991910 CACTGTGCTAGGTCCTGTGGAGG - Intronic
1098571751 12:71995659-71995681 GGCTCTGGTGGGGGCTGTGGTGG + Intronic
1101487928 12:105184711-105184733 GACTCTGGTGGTTCCTGACGGGG - Intronic
1103479953 12:121244525-121244547 GCCTCTGCTGGGGCCTGAGGGGG - Intronic
1104648951 12:130517277-130517299 GACTCTGTAGGGTCCCAAGGTGG - Intronic
1105000718 12:132688054-132688076 GCCCCTGTTGGGTCCTTGGGTGG - Intronic
1106000642 13:25719906-25719928 GGCTCTGGTGGGGCCTCTGGTGG + Intronic
1106592656 13:31110731-31110753 GACTCTCTTGGCTCCTCTGTCGG - Intergenic
1108351791 13:49594734-49594756 GATGCTCTTGGGACCTGTGGAGG - Intergenic
1109444400 13:62414194-62414216 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1110485845 13:76040956-76040978 GACTCTGATGGTCCCTGTTGTGG + Intergenic
1112044931 13:95587206-95587228 GGCGCTGTTGGTTCCTGTGAGGG - Intronic
1112163925 13:96897430-96897452 GAATCTCTTGAGTCCTGGGGAGG + Intergenic
1113047126 13:106168134-106168156 AACTCTGTCAGGTCCTCTGGAGG - Intergenic
1113285225 13:108839110-108839132 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1114537639 14:23433007-23433029 GACACTCTTGGCTCCTGGGGTGG + Intronic
1117615336 14:57528499-57528521 GTCTCTGCTGGGTCATGTGTTGG - Intergenic
1119814962 14:77557808-77557830 GGCTCTGTTGGTTCTTATGGTGG + Intronic
1121753118 14:96375815-96375837 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1123385751 15:19799537-19799559 GAGTGCTTTGGGTCCTGTGGTGG - Intergenic
1128219659 15:65959205-65959227 GACTCTGTTGGGCCCTGAGAAGG - Intronic
1131050905 15:89347214-89347236 GACTCTGATGGGTCTTGTTTGGG + Intergenic
1131941587 15:97572593-97572615 CACTCTGTTGTTTCCTGTGAAGG + Intergenic
1132028124 15:98420072-98420094 GTCGCAGGTGGGTCCTGTGGGGG + Intergenic
1133870763 16:9683669-9683691 GATATTGCTGGGTCCTGTGGTGG - Intergenic
1135153645 16:20032712-20032734 GACTTCGTTGGCTCCTATGGGGG + Intronic
1137950677 16:52780736-52780758 GCCTCTGTTGCATGCTGTGGTGG - Intergenic
1140729550 16:77843696-77843718 GCCTCTGTTTGGCCCTGTGAAGG - Intronic
1141854093 16:86669421-86669443 TTCCCAGTTGGGTCCTGTGGGGG + Intergenic
1143245570 17:5482507-5482529 GAACCTGTTGGTTACTGTGGAGG + Intronic
1143321951 17:6074291-6074313 AAATCTGTTGGGCCCTTTGGGGG - Intronic
1143916407 17:10296644-10296666 GACTCTGTTATGTACTGTGAAGG + Intergenic
1147745125 17:42690214-42690236 GTCTCTGTTGGGTGGTGAGGGGG + Intronic
1148326521 17:46786333-46786355 GACTGTGTTTGGTCCTGGGGAGG - Intronic
1149632650 17:58139654-58139676 GACTCTGAGGAGTCCTGAGGTGG + Intergenic
1154130120 18:11729671-11729693 GATTCTGCTGGGTGGTGTGGAGG - Intronic
1157023722 18:43817432-43817454 GACTCTGAAGAGTCCTGAGGTGG - Intergenic
1164410901 19:28003879-28003901 GACTCTGTTGGTCACTGTGTGGG + Intergenic
1165047138 19:33114120-33114142 CACTGTGTAGGGTCCTGGGGAGG - Intronic
1167250285 19:48395597-48395619 TTCTCTGTTGGATGCTGTGGGGG + Intronic
1167579313 19:50332532-50332554 GACCCTGGTGGGGTCTGTGGAGG - Intronic
925993090 2:9269480-9269502 GGCCCTGTAGGGTTCTGTGGGGG + Intronic
927682010 2:25145992-25146014 GACTCTGTATGGTACTCTGGTGG - Intronic
928058373 2:28082824-28082846 GATTCTGTTCGTTGCTGTGGAGG + Intronic
931454933 2:62401961-62401983 GACTCTGTTCTGTTCTGTTGTGG - Intergenic
931924664 2:67058282-67058304 GACTCTGTTTGCTCCTGGGTAGG - Intergenic
932902805 2:75718618-75718640 GACTTTGTTGGTGGCTGTGGAGG - Intergenic
937472188 2:122183645-122183667 GGCTCTGGTGGGTCCTGAAGAGG + Intergenic
938679166 2:133671587-133671609 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
941636777 2:167943447-167943469 GACTCTATTGGGTAGTGTGATGG - Intergenic
942362570 2:175187800-175187822 CACTCTGTTAGGTGCTGTGAAGG - Intergenic
944287718 2:197970751-197970773 GACACTGTTGGATGTTGTGGGGG - Intronic
1169252184 20:4069204-4069226 GAACCTGTTGGGTCCTGTAGGGG + Intergenic
1169395070 20:5221825-5221847 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1171735290 20:28774438-28774460 GAGTCTTTTGAGTCCTGTGTTGG - Intergenic
1172054557 20:32145054-32145076 GACTCAGTCTGTTCCTGTGGTGG - Intronic
1172192751 20:33071824-33071846 GACTCTGTTGGGGCTGGAGGTGG - Intronic
1172607161 20:36221818-36221840 GTCACTCTTGGGTCCTGTTGGGG - Intronic
1173807827 20:45937509-45937531 GCCTCTGTGGGACCCTGTGGGGG + Exonic
1173844064 20:46177071-46177093 GCCTCTGCTGGGACCTGAGGAGG + Intronic
1174723080 20:52834432-52834454 GACTCAGTTGGGAGCGGTGGAGG - Intergenic
1175402226 20:58707277-58707299 GACCCTGGTGGGGCCTGTGGCGG - Intronic
1179047938 21:37863292-37863314 TACTGTGTTGGTTACTGTGGAGG - Intronic
1179370235 21:40800123-40800145 GACTCTGTAAAGTCCTGAGGTGG - Intronic
1180112839 21:45672202-45672224 GACTCTGCAGAGTCCTGAGGTGG - Intronic
1180139317 21:45882055-45882077 GAGACTGCTGGATCCTGTGGTGG + Intronic
1180800921 22:18631489-18631511 GACCCTGTTGGGCCCTGAGGAGG - Intergenic
1181220796 22:21363773-21363795 GACCCTGTTGGGCCCTGAAGAGG + Intergenic
1181430633 22:22879548-22879570 GACTCTGTTCTGTCCCCTGGTGG - Intronic
1182890477 22:33814315-33814337 GACCCTGTTGGGCCCTATTGGGG - Intronic
1185162267 22:49237078-49237100 GTCTCTGCTGGGCCCTGTGCAGG - Intergenic
949738099 3:7197949-7197971 GACCCAGTTGGGTACTCTGGTGG + Intronic
949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG + Intronic
951103530 3:18716786-18716808 TACTCAGTTGTGTCCTGTGCTGG - Intergenic
952413064 3:33066436-33066458 GACTCTGCAGAGTCCTGAGGGGG - Intronic
953683346 3:45056868-45056890 GACTCTGTTTGGACCTTTAGAGG + Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
954420086 3:50414210-50414232 GGCTCTGTGTGGGCCTGTGGGGG - Intronic
955214834 3:56976675-56976697 GACTGTGGTGGGTCCTGTATTGG - Intronic
955402265 3:58600868-58600890 GGTTTTGTCGGGTCCTGTGGGGG - Intronic
955560006 3:60178575-60178597 GACTCTGTTGGTGGCGGTGGGGG + Intronic
956741990 3:72282353-72282375 GACTCTGTAGAGTCCTGGGATGG - Intergenic
957997656 3:87710732-87710754 GACTCTGTAGAGTCCTGAAGGGG - Intergenic
959238503 3:103756888-103756910 AACTCTTTTCAGTCCTGTGGAGG - Intergenic
960147053 3:114214662-114214684 GACTCTGTGACCTCCTGTGGTGG - Intergenic
960745042 3:120878284-120878306 GACTCTGTTGAGTTCTGTAAAGG + Intergenic
960766293 3:121134180-121134202 GACTCTGTGGTGTCCCGAGGTGG + Intronic
961618239 3:128200867-128200889 GACACTGTAGGGTCAAGTGGAGG + Intronic
963344283 3:144075287-144075309 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
964400011 3:156289016-156289038 CACTCTGTGTGGTCCTATGGGGG + Intronic
966932384 3:184684328-184684350 GACTCTGGTGGCTCCTGGGTGGG + Intronic
968048767 3:195639339-195639361 GTTTCTGTTGTGTTCTGTGGTGG + Intergenic
968305851 3:197650585-197650607 GTTTCTGTTGTGTTCTGTGGTGG - Intergenic
968905704 4:3449683-3449705 GACTCTGCTGGGGCCTGGAGAGG - Intergenic
969058347 4:4415759-4415781 GACTCTGCTGGGTGCCGAGGTGG + Intronic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
972232625 4:37093259-37093281 CACTGTGTTCAGTCCTGTGGGGG - Intergenic
975337645 4:73198759-73198781 GATTTTGTTGGGATCTGTGGTGG - Intronic
977221618 4:94344516-94344538 GGCTCTGTTGGGTACTGGGCAGG - Intergenic
977953954 4:103005429-103005451 GAATCTGTTTGCTTCTGTGGTGG - Intronic
978443180 4:108756183-108756205 GGCTCTCTTGGTTACTGTGGGGG - Intronic
981361021 4:143845743-143845765 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981371759 4:143966745-143966767 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981380849 4:144069943-144069965 GATTCTGTAGAGTCCTGAGGTGG + Intergenic
985505247 5:275820-275842 GTTTCTGTTGTGTTCTGTGGTGG + Intronic
985742880 5:1629800-1629822 GTTTCTGTTGTGTTCTGTGGTGG - Intergenic
985850935 5:2388665-2388687 GACTCTGTTGGTGACTGAGGGGG - Intergenic
985918386 5:2946067-2946089 AGCTCTGTTGGGTTCTGGGGTGG + Intergenic
986737961 5:10681766-10681788 GACTCTGTTGGGCGCTGTCCTGG - Intronic
989187409 5:38638530-38638552 GACTCAAGTGGGTGCTGTGGAGG + Intergenic
999617777 5:153443326-153443348 GACTCTGCAGAGTCCTGAGGAGG + Intergenic
1001990912 5:176114589-176114611 GCCTCTGTGGGGGCCTGGGGTGG + Exonic
1002225962 5:177723551-177723573 GCCTCTGTGGGGGCCTGGGGTGG - Exonic
1003613795 6:7636913-7636935 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1003863546 6:10343495-10343517 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1004833948 6:19509682-19509704 GAATCTGTGTGGTCCTGTGTTGG + Intergenic
1005006469 6:21292275-21292297 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1006168447 6:32079534-32079556 TGCTCTGGTGGGTTCTGTGGGGG + Intronic
1006803048 6:36771610-36771632 CACTGTGTTGGGTGCTGTGGGGG - Intronic
1010145313 6:72661923-72661945 CACTCTATTGGGTGCTGTGATGG - Intronic
1015413804 6:132925295-132925317 GACTGTATTGGGTCCTATGCAGG - Intergenic
1015759940 6:136647887-136647909 GACTGTGCTGGTTCCTGAGGAGG - Intronic
1017484226 6:154888344-154888366 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1017764659 6:157596763-157596785 GTCTGTGCTGGGTGCTGTGGTGG - Intronic
1023966465 7:44965436-44965458 GACCATCTTGGGTACTGTGGTGG - Intronic
1024378701 7:48669174-48669196 GACTCTGTTGGGTGCTCTGATGG - Intergenic
1024985611 7:55191040-55191062 CACTCTGTTGGGCGCTGTGCTGG + Intronic
1026925564 7:74190457-74190479 GCCTCTGTTAGAGCCTGTGGGGG + Intronic
1027263125 7:76479114-76479136 GGTTCTGGTGGGTGCTGTGGAGG + Intronic
1027314509 7:76977219-76977241 GGTTCTGGTGGGTGCTGTGGAGG + Intergenic
1028534094 7:91872028-91872050 GACTCTGAAGAGTCCTGAGGCGG - Intronic
1029113274 7:98224068-98224090 GGCTCTGATGGGGCCTGGGGAGG - Intronic
1029324749 7:99796557-99796579 AACTTGGTTGGGTGCTGTGGGGG - Intergenic
1032306047 7:130733528-130733550 GCCTCTGGTGGGTTCTCTGGAGG - Exonic
1032353011 7:131183443-131183465 TTCTCTGTCTGGTCCTGTGGAGG + Intronic
1032850984 7:135795193-135795215 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1034436043 7:151063183-151063205 GACTCAGGTGGGGGCTGTGGGGG + Intronic
1035492697 7:159294205-159294227 AACGCTGTGGGGTCCTGGGGGGG - Intergenic
1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG + Intronic
1038158829 8:25017226-25017248 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1038271102 8:26076667-26076689 GACTCTGTTTGGCCATGGGGAGG - Intergenic
1040351309 8:46571810-46571832 CACTCTGTGGGCTCCTGTGCCGG + Intergenic
1045518132 8:102879144-102879166 GACTCTGCAGTGTCCTGAGGTGG - Intronic
1048697482 8:137044415-137044437 GACACTGTGGGATCATGTGGTGG - Intergenic
1049593109 8:143471532-143471554 GAGCCTGATGGCTCCTGTGGTGG - Intronic
1050027067 9:1346487-1346509 GACTCTGGTAAGTCCTATGGAGG - Intergenic
1051525079 9:18033843-18033865 TACTATGTTGGGTTATGTGGAGG - Intergenic
1052535339 9:29739187-29739209 TTTTCTGTTGAGTCCTGTGGAGG + Intergenic
1055020627 9:71665593-71665615 GACTCTGAAGAGTCGTGTGGCGG - Intergenic
1055843898 9:80537699-80537721 GACTCTGCAGGGTTCTGAGGTGG - Intergenic
1056655438 9:88504863-88504885 GCCACTGCTGGGTCCTGTGTGGG + Intergenic
1056783803 9:89573482-89573504 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1058562973 9:106249359-106249381 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1059341704 9:113601089-113601111 GAATCTGGTGGGTCCAGAGGTGG - Intergenic
1060867370 9:127010976-127010998 GGGTCTTTTGGGTTCTGTGGAGG + Intronic
1061709855 9:132480168-132480190 GAGTCTGGTGGCTCCTGGGGAGG - Intronic
1061770952 9:132920893-132920915 GCCTCTGTAGGGCCCTGGGGAGG + Intronic
1062618630 9:137409249-137409271 GACTCCGAAGGGTCCTGAGGCGG - Intronic
1187281944 X:17864157-17864179 CACTCTGTTGGTTGGTGTGGTGG + Intergenic
1187813857 X:23209733-23209755 GATTCTGGAGAGTCCTGTGGAGG - Intergenic
1188934060 X:36152421-36152443 GCCACTGTTGGGTCAGGTGGTGG - Intergenic
1189863465 X:45297758-45297780 GACTTTGGTGGCTCCTGGGGAGG - Intergenic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1190276382 X:48902179-48902201 GAGGCTGCTGGGTCCTGGGGTGG + Intronic
1192444443 X:71200136-71200158 AACTCTGTTAGGGGCTGTGGAGG - Intergenic
1196095177 X:111791195-111791217 GATGCTCTTGGGACCTGTGGAGG - Intronic
1196317891 X:114250745-114250767 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1200777523 Y:7182778-7182800 GATTCTTTTGGCTCCTGTGTAGG + Intergenic
1201391138 Y:13498588-13498610 GACCCTGTGGTGTTCTGTGGAGG + Intergenic
1201683480 Y:16675562-16675584 TACTGTGTTGGGTCCTGGGATGG + Intergenic