ID: 949739424

View in Genome Browser
Species Human (GRCh38)
Location 3:7213557-7213579
Sequence GACACAGATGTATATACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949739424 Original CRISPR GACACAGATGTATATACAGG AGG Intronic
903196710 1:21694980-21695002 TACATATATGTAAATACAGGTGG + Intronic
906846725 1:49200678-49200700 GATACAGATGAATAGACAGATGG + Intronic
907313248 1:53551858-53551880 GAGACAGACATATACACAGGAGG - Intronic
907762532 1:57375538-57375560 GACACAGAAATATATGCAGTAGG + Intronic
910720339 1:90279242-90279264 GATACTGATTTATATAGAGGAGG - Intergenic
910785285 1:90990984-90991006 GACACATATATATACTCAGGAGG - Intronic
912243287 1:107934543-107934565 GACAAAGATGTGTCTCCAGGAGG + Intronic
912857863 1:113187763-113187785 GATACAAATGTATATGCATGAGG - Intergenic
913008001 1:114653832-114653854 GACAAAGATATATGTACAAGAGG + Intronic
916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG + Intergenic
918464558 1:184808073-184808095 GACACAGAACTACATGCAGGAGG - Exonic
919837375 1:201584309-201584331 GACAGAGCTGCATATAGAGGGGG + Intergenic
920256709 1:204660275-204660297 GAGACACATCTATAAACAGGAGG - Intronic
921602601 1:217122538-217122560 AGCCCAGGTGTATATACAGGAGG + Intronic
924175823 1:241390259-241390281 GACACAGAGAAATAGACAGGAGG - Intergenic
1063233137 10:4085816-4085838 GACCCTGATCTATATATAGGGGG - Intergenic
1065162339 10:22935902-22935924 GACAGAGATAGATAAACAGGAGG - Intronic
1067514610 10:46927485-46927507 GTCACATATGTAAATTCAGGGGG - Intronic
1067647650 10:48124328-48124350 GTCACATATGTAAATTCAGGGGG + Intergenic
1068529814 10:58173248-58173270 GACACAGACATACATAGAGGGGG + Intergenic
1068733669 10:60387998-60388020 GGCAGAGATGTATGGACAGGGGG + Intronic
1069061740 10:63901887-63901909 GTGACAGATGTAGATGCAGGGGG + Intergenic
1069699526 10:70411829-70411851 GAGACAGAAGTATATACATTGGG - Intronic
1069833614 10:71295507-71295529 CAGACAGATGAATATACAGATGG - Intronic
1070340824 10:75496845-75496867 TGCACATATGTATATACATGAGG + Intronic
1070340827 10:75496874-75496896 TACACATATGTGTATACATGAGG + Intronic
1070995755 10:80779271-80779293 CACACAGATGTATATATCTGGGG - Intergenic
1073360205 10:102892460-102892482 CACACAGATGCATAAACAGCTGG + Intronic
1075646716 10:124101610-124101632 GACACTGAAATATACACAGGTGG + Intergenic
1075941253 10:126392139-126392161 GACATAGATGAATATAGATGGGG - Intergenic
1076919395 10:133443676-133443698 TACACAGGTGCATACACAGGTGG + Intergenic
1076919407 10:133443798-133443820 TACACAGGTGCATACACAGGTGG + Intergenic
1076919414 10:133443858-133443880 TACACAGGTGCATACACAGGTGG + Intergenic
1077304184 11:1861453-1861475 GAGACAGATGGATAGACAGATGG + Intronic
1080116486 11:28627106-28627128 GACACAGCTGTAAATAAAGGAGG + Intergenic
1080519177 11:33051762-33051784 CACACACATATATATATAGGTGG - Intronic
1081711811 11:45221690-45221712 GAGACATATGAAGATACAGGAGG + Intronic
1081725988 11:45329602-45329624 GACACAGATGTATCTTTTGGGGG - Intergenic
1082682420 11:56192199-56192221 TAAACAGATGAATAAACAGGTGG + Intergenic
1085031517 11:73273765-73273787 GCCACAGATGGAAAAACAGGTGG - Intronic
1085778068 11:79383704-79383726 GAAACACATGTATATATAGTGGG - Intronic
1089777942 11:120851982-120852004 GCAACTGATGTATAGACAGGAGG + Intronic
1092305339 12:7294876-7294898 TACACAGATGTCTAAACAGCTGG + Intergenic
1096482185 12:51949843-51949865 GACAGAGATGTAGATGCAGAGGG + Intergenic
1097958886 12:65513354-65513376 GACACAGAGGCATAGACAGAGGG + Intergenic
1102433352 12:112900736-112900758 GACTGAGATGAACATACAGGAGG + Intergenic
1104402681 12:128489683-128489705 GACTCATATATATATACATGTGG + Intronic
1105797967 13:23875865-23875887 GATACAAAAGTATATACAGTTGG - Intronic
1106578449 13:30997799-30997821 GACCCAGATGAATACACATGGGG - Intergenic
1107357339 13:39582130-39582152 GAGACTGATGTGTCTACAGGAGG - Intronic
1109070200 13:57756065-57756087 GGCAGAGATGTATAGACAGCTGG - Intergenic
1109848280 13:68026177-68026199 GACACTAATGTATATACATTAGG - Intergenic
1110167992 13:72466967-72466989 AACACAGATATATATTCAAGAGG + Intergenic
1110525404 13:76531215-76531237 GAGACAGAAGGATGTACAGGTGG - Intergenic
1112390698 13:98981388-98981410 CACACAGATTTATGTAAAGGGGG + Intronic
1112408227 13:99139505-99139527 TACACAGATGTCTAAACAGCTGG - Intergenic
1112949091 13:104968791-104968813 GACAGTGATGTATATCCTGGAGG + Intergenic
1113304552 13:109063475-109063497 GTCACATATGAATTTACAGGAGG - Intronic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1116304129 14:43228750-43228772 GACTCAGATGTGTATAAAAGCGG - Intergenic
1117490139 14:56238795-56238817 GACAGAGATGTTTAACCAGGAGG + Intronic
1117528807 14:56638888-56638910 GCAACACATGTATATAGAGGAGG + Intronic
1117560078 14:56928503-56928525 GACACACCTGTACCTACAGGGGG - Intergenic
1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG + Intronic
1119339306 14:73862533-73862555 GAAACAGAAGTATATAAAGTAGG + Intronic
1121303174 14:92888094-92888116 GACAATGATGTATAAATAGGTGG + Intergenic
1121492912 14:94372561-94372583 GACACAGATGGAGAAAGAGGGGG + Intergenic
1121701388 14:95956974-95956996 GACTCAGATTCAAATACAGGAGG - Intergenic
1124216073 15:27808022-27808044 GACACAGGTGCCTTTACAGGTGG + Intronic
1124783408 15:32657193-32657215 TACATATATATATATACAGGAGG - Intronic
1125376960 15:39040337-39040359 GACACATATGTAAATGCATGAGG + Intergenic
1125858802 15:42977888-42977910 GAAACAGATCTATAGACAGAAGG + Exonic
1126437422 15:48649621-48649643 GACATAGATATTTATACAGGAGG - Intergenic
1127708102 15:61567204-61567226 GTCACTGATGTCTATACAGCAGG - Intergenic
1130054074 15:80507346-80507368 GACAGAGATGTGTGTGCAGGCGG + Intronic
1132042155 15:98534551-98534573 AGCACAGATGAACATACAGGTGG + Intergenic
1139728124 16:68918855-68918877 GACACAGATGAACAGACAGATGG - Intronic
1141616052 16:85209973-85209995 GACACAGCAGTAAATACATGGGG + Intergenic
1143506500 17:7368675-7368697 GATACAGATGAATAACCAGGTGG - Intergenic
1145932702 17:28697482-28697504 GACACAGATGGATAAACTGAGGG + Intronic
1147472648 17:40677248-40677270 GGCACACATGTATATCCACGGGG + Intergenic
1147627213 17:41907953-41907975 GACATAGATGTGCATACCGGTGG - Intronic
1149226604 17:54478772-54478794 GAAACAGATTTAAAAACAGGTGG - Intergenic
1150155059 17:62845974-62845996 GATACTGAAGAATATACAGGTGG + Intergenic
1153756574 18:8289631-8289653 TACACACATATATATATAGGCGG + Intronic
1155759483 18:29548191-29548213 GATACAGATGTAAAGACATGTGG - Intergenic
1157754694 18:50207274-50207296 CACACATATATATATACAGTTGG - Intergenic
1158166880 18:54549932-54549954 TACACAGATGTCTAAACAGCTGG - Intergenic
1159247277 18:65823818-65823840 GAAACAGAAGTAGATGCAGGAGG + Intronic
1163836409 19:19577391-19577413 TACAAAGATGTATTTACAGGAGG + Intronic
1165192067 19:34072993-34073015 GATACATATATATGTACAGGAGG + Intergenic
1165673483 19:37700252-37700274 GATATAAATTTATATACAGGGGG - Intronic
925710158 2:6731395-6731417 GAAACAGATAAATAAACAGGAGG + Intergenic
925807667 2:7667103-7667125 GAAACTGATGTATCTACAGAAGG - Intergenic
926986474 2:18630253-18630275 CACACAGATTTAGATGCAGGTGG - Intergenic
928889170 2:36182079-36182101 GATATAGATATATATATAGGTGG + Intergenic
932088022 2:68779683-68779705 GACAGAAATGTTTATGCAGGAGG - Intronic
932210575 2:69925751-69925773 GACAGAGATTTTTCTACAGGTGG - Intronic
933246014 2:79975716-79975738 GATACAGATGAATAACCAGGTGG + Intronic
935469922 2:103446470-103446492 GACACAGATGTATTTTCAAAGGG + Intergenic
935553418 2:104481769-104481791 GACAAAGATGTATATCCAGCTGG + Intergenic
936002603 2:108849402-108849424 GGCACACATGTATCTAGAGGAGG - Intronic
936229753 2:110689684-110689706 CTCACAGATGTTTATACAGCTGG + Intergenic
938254136 2:129841201-129841223 GACACATACATATATACAAGTGG - Intergenic
939028164 2:137039112-137039134 GCCACTGATGTATATTCAGCAGG - Intronic
940739943 2:157495791-157495813 GAAATATATGTATATACAGTTGG + Intergenic
941356983 2:164505699-164505721 CACTCAGATGTATATACATATGG - Intronic
942322767 2:174750398-174750420 GACACAGATGCATAGACGGAAGG + Intronic
942338572 2:174918186-174918208 CACACACATGTATGTACAGTGGG - Intronic
947356986 2:229306993-229307015 GACACAGACATGTACACAGGAGG - Intergenic
949038599 2:241833825-241833847 GACACATATGCATATTCAGCAGG + Intergenic
1173310755 20:41894241-41894263 TACACATATGTATACACACGTGG + Intergenic
1175564802 20:59964931-59964953 GAAACAGGTGTATTTCCAGGTGG - Intronic
1177073238 21:16538543-16538565 GACACAGATGTATATATTTAAGG + Intergenic
1177450944 21:21265711-21265733 GATACACATGGATATATAGGTGG + Intronic
1180934063 22:19612508-19612530 CACACATATGAATAGACAGGGGG - Intergenic
1181115492 22:20630547-20630569 GACAGACATGAATAAACAGGTGG + Intergenic
1181495959 22:23287649-23287671 GACAGACATGTATTGACAGGAGG - Intronic
1182400937 22:30077254-30077276 GACACAGGTGAAAATAGAGGAGG - Intergenic
1182535000 22:30994417-30994439 GGGACAGATGTATATAAAAGGGG + Intergenic
1182619123 22:31608831-31608853 TCCAAAGATGTATATACAGCAGG - Intronic
1183304200 22:37073405-37073427 CATACAGATGTAAATACAGAGGG + Intronic
949739424 3:7213557-7213579 GACACAGATGTATATACAGGAGG + Intronic
956912143 3:73829083-73829105 CACACAGAGGTATGTAGAGGTGG + Intergenic
957951390 3:87131865-87131887 AAGACAGATGTATATATAAGGGG + Intergenic
959600729 3:108181813-108181835 GTAACAAATGTAAATACAGGTGG - Intronic
961707463 3:128798862-128798884 GAAAGAGATGAAAATACAGGAGG - Intronic
963700757 3:148623135-148623157 TACATATATGTATATATAGGGGG - Intergenic
963931783 3:151011071-151011093 GATACACATGGATATACAGAGGG + Intergenic
963941037 3:151096550-151096572 GAAACAGATATAAATAAAGGAGG - Intronic
964134281 3:153326998-153327020 GACAGATATGTATATATACGAGG + Intergenic
964717030 3:159733331-159733353 GATTGAGATGTATATACAGCTGG + Intronic
969520731 4:7676317-7676339 GAGACAGCTATATAGACAGGCGG - Intronic
970133752 4:12899280-12899302 AACACACATGTACATACAGTCGG + Intergenic
970156533 4:13147717-13147739 GACATATATGTATATACATTTGG - Intergenic
971791215 4:31172233-31172255 CACACACATGCATATACAGGAGG + Intergenic
971945104 4:33265298-33265320 TACACAAATATATATACAGAGGG - Intergenic
973159599 4:46999177-46999199 CACAAAGATGTAAATACTGGAGG + Intronic
975235409 4:71989719-71989741 GGCAGAGGTGGATATACAGGAGG + Intergenic
975594897 4:76040694-76040716 GACAAAGATGTGTCTACATGGGG - Intronic
975842114 4:78486107-78486129 GCCACAGATGCACACACAGGAGG - Intronic
978011058 4:103685197-103685219 GAAACAGATGTACATAAACGTGG + Intronic
978227577 4:106355966-106355988 TACACACATGTATACACAGTAGG + Intergenic
978831983 4:113097826-113097848 CACACACATATATATACAAGAGG - Intronic
978892112 4:113842153-113842175 GACACTTATGAATTTACAGGTGG - Intergenic
979289527 4:118964622-118964644 GAGAAAGATGGAGATACAGGTGG - Intronic
981094803 4:140767684-140767706 CACACACTTTTATATACAGGTGG - Intergenic
981598742 4:146459507-146459529 GAAACAGATCTATATAGAGATGG + Intronic
981678664 4:147368657-147368679 TACACAGATGTATATGCAGCTGG - Intergenic
981956830 4:150485562-150485584 GACACAGAGACATACACAGGGGG + Intronic
982163367 4:152592047-152592069 GACACAGATTTATTTTCAAGAGG - Intergenic
985128853 4:186722232-186722254 GAGACAAATGAATATACAGGTGG + Intronic
985776304 5:1844785-1844807 GATATAGGTGTAGATACAGGTGG - Intergenic
986101276 5:4613936-4613958 GACATAAAAGTATATACAGATGG + Intergenic
986409313 5:7460945-7460967 GCCACAGTTGTTTATATAGGAGG + Intronic
986980050 5:13437174-13437196 GATACAGATACAGATACAGGAGG - Intergenic
987111886 5:14695692-14695714 TCAACAGATGTATATACAGAAGG - Exonic
987957608 5:24761599-24761621 GTCACACATCTAGATACAGGAGG - Intergenic
988163075 5:27546283-27546305 GACAGAGTTATATATACATGAGG - Intergenic
989023570 5:37040421-37040443 GACACAGAGGTATATATAAATGG + Intronic
990767408 5:59201986-59202008 TACACAGATATACAAACAGGTGG - Intronic
990934370 5:61131794-61131816 TAAACACATGTATATGCAGGGGG + Intronic
995428151 5:112047110-112047132 GAGACAGATGTATATATATAAGG + Intergenic
995754928 5:115492825-115492847 CACACAGATGCACATACAAGAGG + Intergenic
998274105 5:140735551-140735573 CACACAGATGCATAAACAGCTGG + Intergenic
998596904 5:143540625-143540647 AACACATATATATATATAGGTGG + Intergenic
1000800733 5:165723044-165723066 CACACAGAGTTTTATACAGGAGG - Intergenic
1004235637 6:13872601-13872623 GAACCAGAAGTATAGACAGGAGG - Intergenic
1004548250 6:16620713-16620735 GGCACAGGTGTATTTACAGCTGG + Intronic
1004758620 6:18641250-18641272 GACACAGACAGATACACAGGGGG + Intergenic
1005685584 6:28250487-28250509 CACACAGATGTATATAATGAGGG - Intronic
1009691340 6:67037311-67037333 CACACAGATTTTTACACAGGAGG + Intergenic
1009737127 6:67690490-67690512 TACACAGATGTCTAAACAGTTGG + Intergenic
1010033912 6:71299614-71299636 GAAAAAGATGTATAAAAAGGTGG - Intronic
1010292589 6:74155665-74155687 GACACAGATAGATATAGATGTGG - Intergenic
1011841219 6:91501449-91501471 GCCATAGATGTTTATGCAGGAGG + Intergenic
1012164300 6:95929408-95929430 CACACACATATATATAGAGGTGG - Intergenic
1012924915 6:105258080-105258102 GACACTGAGGTCTAGACAGGTGG + Intergenic
1013001290 6:106024907-106024929 GAAACAGTTGTATGTAGAGGAGG + Intergenic
1014118226 6:117690411-117690433 GACATAGATATATATACACTTGG - Intronic
1018473566 6:164118539-164118561 GAGACAGATGTGTAAACAGATGG + Intergenic
1018952298 6:168387166-168387188 AACACACATGTATACACACGTGG - Intergenic
1024941313 7:54765896-54765918 GACACAGATGTACAGAAAGAAGG + Intergenic
1027522362 7:79225171-79225193 GAGACAAATGTATGCACAGGTGG - Intronic
1027957314 7:84897301-84897323 GGCACTGATATAGATACAGGTGG - Intergenic
1028525529 7:91781407-91781429 CACACAAATGTATATAAAAGTGG - Intronic
1029934240 7:104406642-104406664 GACACAGGTAGATATGCAGGAGG + Intronic
1031059848 7:117038741-117038763 TACACAGATATATGTAAAGGGGG + Intronic
1033520214 7:142152915-142152937 GGCACAGATGAACATACAGTGGG - Intronic
1034006641 7:147479480-147479502 GAGACAGATGAATAGACAGATGG + Intronic
1034365461 7:150542583-150542605 CACACACATGCTTATACAGGGGG - Intergenic
1035612961 8:980614-980636 GACACAGAGGTGAATCCAGGTGG + Intergenic
1036116493 8:5965839-5965861 GACACAGATGAATAGCCAGTCGG - Intergenic
1036271877 8:7312667-7312689 GACACATAAGTACATAAAGGTGG - Intergenic
1036349469 8:7997678-7997700 GACACATAAGTACATAAAGGTGG + Intergenic
1043303397 8:78762673-78762695 GACACAGATACAAATACAAGAGG - Intronic
1043325694 8:79048156-79048178 TACACAGATGTAAATAAATGAGG + Intergenic
1044043863 8:87404651-87404673 AACACAGATGTATACACTGTGGG - Intronic
1044562014 8:93621652-93621674 GACACTGATGTAAATGAAGGAGG - Intergenic
1047606846 8:126483247-126483269 GAGAGAGATATATATACACGTGG - Intergenic
1049381525 8:142318744-142318766 GAGACAGATGGATGGACAGGCGG + Intronic
1050718975 9:8563385-8563407 CACACATATGCATATACAGATGG + Intronic
1055372804 9:75618596-75618618 GACACAGATATATATTCATCAGG - Intergenic
1055669060 9:78582303-78582325 GACACTGATGTCTAGACCGGGGG + Intergenic
1056042835 9:82685797-82685819 GAAACACATGGATATCCAGGTGG - Intergenic
1062723804 9:138059581-138059603 GGCAAAGAGGTATATATAGGTGG - Intronic
1185995166 X:4938782-4938804 GTCACAGTTGTCAATACAGGAGG - Intergenic
1191853058 X:65600291-65600313 TACACAGATGCATATGCAGGAGG - Intronic
1195004690 X:100674147-100674169 GAGAGAGATGTTCATACAGGAGG - Intergenic
1195412256 X:104580275-104580297 AACACAGATGTCTATATAGAAGG - Intronic
1198546729 X:137700281-137700303 CACACATATGTATACACATGTGG - Intergenic
1198736657 X:139792815-139792837 GACACAGATGAAGAGACATGTGG - Intronic
1199777410 X:151026691-151026713 GACACAGACATAAACACAGGTGG - Intergenic
1201623317 Y:15984327-15984349 TATACATATGTATATACATGGGG - Intergenic