ID: 949742176

View in Genome Browser
Species Human (GRCh38)
Location 3:7248966-7248988
Sequence GATCTATATTTATTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949742176_949742177 4 Left 949742176 3:7248966-7248988 CCAGGAGAAAATAAATATAGATC 0: 1
1: 1
2: 0
3: 27
4: 368
Right 949742177 3:7248993-7249015 GACAGCCATAGATATGAACATGG 0: 1
1: 0
2: 1
3: 6
4: 174
949742176_949742179 30 Left 949742176 3:7248966-7248988 CCAGGAGAAAATAAATATAGATC 0: 1
1: 1
2: 0
3: 27
4: 368
Right 949742179 3:7249019-7249041 TAGATATTTACATTAACTCGAGG 0: 1
1: 0
2: 1
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949742176 Original CRISPR GATCTATATTTATTTTCTCC TGG (reversed) Intronic
900162499 1:1230943-1230965 GAACTAGCTTTATTTTCTCTAGG - Intronic
900939449 1:5788728-5788750 GATCTATATTTTCTGTCTTCAGG - Intergenic
902116864 1:14128403-14128425 CATCAACATTTATTTTCTCTGGG + Intergenic
902177409 1:14661309-14661331 GAGCCATCTTTATTTTCTCATGG + Intronic
903808150 1:26020053-26020075 GTTCTATAATTGTCTTCTCCAGG + Intronic
905698317 1:39992522-39992544 GATATATATTTTTTTGCTACAGG + Intergenic
906896986 1:49785880-49785902 TATATATATTTTTTTTTTCCTGG - Intronic
906987893 1:50706560-50706582 GTTCTATTTTTATCTCCTCCTGG + Intronic
907105179 1:51876685-51876707 AGTCTAGATATATTTTCTCCAGG - Intronic
907668757 1:56456056-56456078 TAGCTTTATTTATTTTTTCCTGG - Intergenic
907845712 1:58204593-58204615 GAACTTTATTGATTCTCTCCTGG - Intronic
908015511 1:59829388-59829410 GATGCATATTTAATTTCTCTTGG + Intronic
908543885 1:65146751-65146773 AATCAATATTTATTATTTCCCGG - Intergenic
909097606 1:71307817-71307839 GATCTATCTTCATCTTCTGCAGG + Intergenic
909308786 1:74118670-74118692 TCTCTATATTTTTTTTCTACTGG - Intronic
909880633 1:80872823-80872845 GATTTTTTTTTCTTTTCTCCCGG - Intergenic
910373125 1:86539604-86539626 AATCTATAAGTACTTTCTCCTGG + Intergenic
910611883 1:89153361-89153383 CATTTATATTGATTTTCTCAGGG + Intronic
910722687 1:90303992-90304014 GAGAAGTATTTATTTTCTCCTGG + Intergenic
911002186 1:93178404-93178426 GATTAAATTTTATTTTCTCCAGG + Intronic
911207674 1:95108708-95108730 GATTTAACTTTATTTTTTCCAGG + Intergenic
911705085 1:101001898-101001920 GAACTCTTTTTTTTTTCTCCTGG - Intronic
912601617 1:110940426-110940448 GCTCTATTTTTATTTTTTTCAGG - Intergenic
912720941 1:112019356-112019378 GCTCTATATTTTTTTTCCACTGG + Intergenic
913065573 1:115250772-115250794 GTTCTATATTTAATTTTTCGAGG - Intergenic
913142740 1:115957274-115957296 GTTCTATATTCCCTTTCTCCAGG - Intergenic
913398627 1:118402638-118402660 CATATATTTTTATTTTCTCTGGG - Intergenic
915017081 1:152744218-152744240 GAACTATTATTTTTTTCTCCTGG - Intronic
916239067 1:162621357-162621379 GATCTTTATTTTCTTTCTCTGGG + Intergenic
916723923 1:167506051-167506073 GATCTGTATTATTTTTCTCTAGG + Intronic
917413743 1:174786638-174786660 GACCTTTATTTATTTTCTTATGG + Intronic
918088469 1:181265639-181265661 GATAAATATTTATTTGCTGCAGG - Intergenic
918494202 1:185115206-185115228 CATCTACATTGGTTTTCTCCTGG + Intergenic
918697768 1:187564765-187564787 TATCAAGTTTTATTTTCTCCCGG - Intergenic
919363072 1:196619792-196619814 TATCCATATTTATTATTTCCAGG - Intergenic
919698526 1:200606895-200606917 GATTTGTCTTTATTTTATCCAGG + Intronic
921798290 1:219372925-219372947 GTTCTACATTATTTTTCTCCAGG + Intergenic
922045368 1:221940233-221940255 GAACAATATTTTTTTTCTCCAGG + Intergenic
1063201897 10:3792096-3792118 GTTCAATATTTATTGTCTTCAGG + Intergenic
1063633131 10:7753564-7753586 GATTTATATGTATTTTCTGTAGG + Exonic
1064213291 10:13378905-13378927 GACATATATTTCGTTTCTCCTGG - Intergenic
1066594417 10:37034283-37034305 TATCTAATTTTATTTTATCCTGG + Intergenic
1066609409 10:37224378-37224400 GATATTTACTTATTTTCTACTGG + Intronic
1066993975 10:42545384-42545406 GATATATATTTTTTTTCTTTTGG - Intergenic
1067168812 10:43887445-43887467 GTTCTATTTTTATTTTCTTTAGG - Intergenic
1068606432 10:59010124-59010146 TTTGTTTATTTATTTTCTCCTGG - Intergenic
1068624006 10:59220101-59220123 GTTTTATTTTTATTTACTCCTGG + Intronic
1069358824 10:67618608-67618630 TAGCTATGTATATTTTCTCCTGG - Intronic
1071250296 10:83811445-83811467 AATCTAGATTAATTTTCTCAAGG + Intergenic
1071723774 10:88175004-88175026 GATGTTTATTCATTTTCTCCAGG + Intergenic
1074546043 10:114403451-114403473 CTTCTATATTTGTTTTCCCCTGG - Intronic
1074831556 10:117253323-117253345 GCTTTATATTGATTTTCGCCTGG - Intronic
1075042691 10:119121108-119121130 AATCTACATTTATTTTGGCCGGG - Intronic
1080253187 11:30258803-30258825 AATAGATATTTATTTTCTCACGG - Intergenic
1081107975 11:39095557-39095579 GATTTATATTTATATTTTCCAGG - Intergenic
1081258108 11:40922715-40922737 AATTTATATTGATTTTCTCTTGG - Intronic
1081471817 11:43380920-43380942 GATCTATTTTTATTTAAACCCGG + Intronic
1084552389 11:69852889-69852911 GATGTATTATTATTTTCTTCAGG + Intergenic
1085070860 11:73543718-73543740 AAGCTATATTTATTTCCTCTGGG + Intronic
1086159444 11:83705204-83705226 GTTCTAAACTTCTTTTCTCCAGG + Intronic
1087093183 11:94296448-94296470 GATGCATATTTGTTTTCTCTAGG + Intergenic
1087252309 11:95916542-95916564 GATCTGTATTGACTATCTCCAGG + Intronic
1087552857 11:99673758-99673780 GATCTTTTTTTTTTTTCTGCAGG - Intronic
1088766432 11:112984439-112984461 GTTCTATTTTTAATTTCTCTAGG + Intronic
1088972938 11:114789567-114789589 GATGTTTATTTTTTATCTCCTGG - Intergenic
1088990468 11:114949209-114949231 GATCTTGATTTATTTACTCTAGG + Intergenic
1089029302 11:115307504-115307526 TATATATATTTTTTTTTTCCTGG - Intronic
1090004232 11:122985821-122985843 GATCTTTATTTCTTTACTCTGGG - Intergenic
1090434031 11:126671502-126671524 GATTTACAAATATTTTCTCCTGG - Intronic
1091293054 11:134452935-134452957 AATCTATATTTATTGTCTTGTGG - Intergenic
1091499796 12:1005154-1005176 AATCTTTATTTATTTTCACCTGG + Intronic
1092675899 12:10918932-10918954 TTTCTATATTTATTTTCTTGAGG + Intronic
1093601463 12:21029734-21029756 GTTCTATATTTAATTTTTTCAGG + Intronic
1094107240 12:26827107-26827129 AAACTATTTTTATTTTCTACTGG - Intronic
1094341329 12:29414732-29414754 TATATATATTTTTTTTTTCCAGG - Intronic
1095213110 12:39517146-39517168 GCTCTATTTTTAGTTTCTCAAGG - Intergenic
1095448959 12:42309526-42309548 AAGCTGTATGTATTTTCTCCTGG + Intronic
1096681476 12:53258287-53258309 GATCCACATTTTTTTTTTCCAGG - Intergenic
1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG + Intergenic
1098266378 12:68725049-68725071 GATCTAGCTTTGTTTTCTTCTGG - Intronic
1098330037 12:69343673-69343695 TATCTATAGGTCTTTTCTCCTGG + Intergenic
1098610760 12:72454563-72454585 TATTTATATTTATTTTTGCCTGG - Intronic
1098807627 12:75039674-75039696 AATTTATATTTATGTTTTCCAGG - Intergenic
1099014558 12:77328600-77328622 TATCTGTATGGATTTTCTCCAGG - Intergenic
1099214037 12:79832490-79832512 GAACTATTTTTATTTTATCAGGG - Exonic
1100156177 12:91803174-91803196 GTTCTATTTTTAATTTTTCCTGG - Intergenic
1100266542 12:92981976-92981998 GCTCTTTTTTTTTTTTCTCCTGG - Intergenic
1100683033 12:96949831-96949853 AATCTATACTTATTTTTTACAGG - Intronic
1104571365 12:129928953-129928975 GATCAATATTTATTTTTTTCTGG - Intergenic
1105767272 13:23574343-23574365 GATCTACATTTTTTTTGTTCTGG + Intronic
1106938858 13:34753983-34754005 CAGCTACAATTATTTTCTCCAGG - Intergenic
1107062152 13:36171222-36171244 CATCAATATTTATTTTCTACTGG + Intronic
1107286157 13:38794974-38794996 GATCTTAAGTAATTTTCTCCAGG - Intronic
1107896678 13:44971666-44971688 GATCTATATAAATTATCTCCTGG + Intronic
1108927598 13:55771651-55771673 TATATATATATATTTTCCCCTGG - Intergenic
1110948370 13:81453430-81453452 TATCAATATATATTTTCTTCAGG - Intergenic
1111505931 13:89187818-89187840 GGTATACATTTATTTTTTCCTGG - Intergenic
1111911638 13:94319669-94319691 GGTCAACAGTTATTTTCTCCAGG + Intronic
1112476622 13:99737149-99737171 AATCCATCTTTATTTTCTGCAGG + Intronic
1114398910 14:22391612-22391634 GATCTAGAATTATTACCTCCAGG - Intergenic
1114846408 14:26328251-26328273 GATATATAATAATTTTCTCTGGG - Intergenic
1115455476 14:33596933-33596955 GATCTAGATTTTATTTATCCAGG + Intronic
1115458939 14:33636990-33637012 CATCTATCTTTGTTTTCTTCCGG + Intronic
1116596355 14:46852112-46852134 TATCTATCTTTATTTTCCACTGG + Intronic
1116765001 14:49059611-49059633 GATTGATATTTATTGTCTTCAGG + Intergenic
1117148848 14:52864622-52864644 CATCAGTATTTCTTTTCTCCAGG - Exonic
1119342928 14:73895939-73895961 GATCTACATTTTATTTTTCCTGG - Intronic
1121706067 14:95994805-95994827 GATCCATATTTATTTTCTCCTGG - Intergenic
1122127976 14:99589475-99589497 GATCTATTTTTATTTTTTAAAGG + Intronic
1122476319 14:102012127-102012149 GATCTGTGTTTGTGTTCTCCTGG + Intronic
1124413591 15:29456656-29456678 GGTTTATACATATTTTCTCCAGG - Intronic
1126222660 15:46232323-46232345 GATTTATATATATTTGGTCCCGG + Intergenic
1126504519 15:49389089-49389111 GTTCTATATTTAATTCCTCAAGG - Intronic
1127023739 15:54780728-54780750 TTTCCATATTAATTTTCTCCTGG - Intergenic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128955766 15:71941677-71941699 GATTTATATTAATTTTCTTTGGG - Intronic
1129414777 15:75369300-75369322 CAGCTTTATTTTTTTTCTCCTGG + Intergenic
1131321112 15:91392102-91392124 CATCCATATTTGTCTTCTCCAGG - Intergenic
1131382991 15:91979988-91980010 GCTCTAGATTCATTTTCCCCAGG - Intronic
1135165762 16:20137840-20137862 GATATATATATATTTTTTACTGG + Intergenic
1139088111 16:63613716-63613738 TTTCTATATTTATTATTTCCTGG + Intergenic
1140444828 16:75017567-75017589 AATCTATATTGATCTGCTCCTGG + Intronic
1140570649 16:76102782-76102804 GATATTTATATCTTTTCTCCAGG + Intergenic
1144412732 17:15017190-15017212 AATATGTATTTTTTTTCTCCAGG - Intergenic
1144644186 17:16959415-16959437 GTTCTATTTTTATTTCCTCAAGG - Intronic
1146169689 17:30623223-30623245 TATCTATATATATCTTCACCAGG + Intergenic
1146298847 17:31672482-31672504 TTTCTATAGTTATTTTCTCTGGG + Intergenic
1146343139 17:32039314-32039336 TATCTATATATATCTTCACCAGG + Intronic
1147114102 17:38285955-38285977 GATATATATTTGTTGCCTCCTGG - Intergenic
1147692376 17:42324476-42324498 GAGGTAGATTTCTTTTCTCCTGG - Intronic
1148018498 17:44538867-44538889 GATCCACATTAATTTTCCCCAGG - Intergenic
1148415502 17:47503235-47503257 GATATATATTTGTTGCCTCCTGG + Intergenic
1149814445 17:59709031-59709053 GTTCTATGTATATTTTCTTCTGG - Intronic
1151612879 17:75188034-75188056 GATTTATATTTATTTTATAATGG - Intergenic
1152010749 17:77712504-77712526 GATCTATGTTTCATTTCTCTTGG + Intergenic
1152440020 17:80301732-80301754 GTTCTATTTTTAGTTTCTTCAGG - Intronic
1153046821 18:863537-863559 GATCCATTTTTATAATCTCCTGG + Intergenic
1153283655 18:3437434-3437456 AATTTATATTATTTTTCTCCTGG + Intronic
1153326990 18:3830656-3830678 GCTCTATATTTGTTTTATCAAGG - Intronic
1153953671 18:10077453-10077475 TTTTTATATTTATTTTCTCAGGG + Intergenic
1155775930 18:29761147-29761169 GATCTATTTTAATGTTCTTCAGG - Intergenic
1156573627 18:38286650-38286672 GATTGCTATTTATTTTCTCTGGG + Intergenic
1159503854 18:69309188-69309210 GATCTATCTTTAAATTCACCAGG + Intergenic
1160398544 18:78590522-78590544 GATCTTTTTTTTTTTTTTCCAGG + Intergenic
1163416690 19:17191168-17191190 TGTCTATCTTCATTTTCTCCAGG - Exonic
1165556319 19:36635741-36635763 GATCTATGTTTAGTTTCTTGAGG + Intergenic
1165979800 19:39710924-39710946 CATCTATTTTCATTTTCTCTGGG + Intergenic
1166080886 19:40443501-40443523 GCTCTAAATTTGCTTTCTCCCGG + Intronic
1168656045 19:58128890-58128912 CATCTATATTGTTTCTCTCCAGG + Exonic
925807875 2:7670082-7670104 GATCTATAATTCTTTCTTCCTGG - Intergenic
928236159 2:29542976-29542998 GATTTATCTTTGTTTTCTCTGGG + Intronic
930049301 2:47202066-47202088 GTTCTATATTTAATTTATCAAGG - Intergenic
930169490 2:48236365-48236387 TATCTGTATTTAGTTTCTCTGGG + Intergenic
930555594 2:52891954-52891976 GATCTTTATTTCTTTTCTTCTGG + Intergenic
931196703 2:60058587-60058609 AATATTTATTTATTTTCTCATGG + Intergenic
932117541 2:69067016-69067038 GGTCTATTCTTATTTTCTCTTGG - Intronic
932123148 2:69119444-69119466 AACCTATATTTATTTCCTCGTGG - Intronic
932957773 2:76375103-76375125 GTTCTATTTTTATTTACTGCTGG - Intergenic
933360601 2:81278517-81278539 GCTACATATTTATTTTGTCCTGG - Intergenic
934141193 2:89049533-89049555 AAAATATTTTTATTTTCTCCAGG - Intergenic
935430090 2:102966622-102966644 AATCTACTTTTATTTTCTACTGG - Intergenic
935830125 2:106993630-106993652 GCTCTGAATTTATTTTCTGCGGG + Intergenic
936862949 2:117039811-117039833 GATTTACAAATATTTTCTCCCGG - Intergenic
937618310 2:123953850-123953872 AACCGATATTTATTTTCTCATGG + Intergenic
938201871 2:129378719-129378741 GATCTTGCTTAATTTTCTCCAGG - Intergenic
938617573 2:133015354-133015376 GAACTCTTTTTTTTTTCTCCTGG + Intronic
940657113 2:156501160-156501182 GATCTTATTTTATTTTCTACAGG - Intronic
941439025 2:165510366-165510388 CATATATATTTATTTTTTCTTGG + Intronic
941510997 2:166409509-166409531 GATCTTTTTTTATTTTCAACAGG - Intronic
941574649 2:167215093-167215115 TATCTATATATAATTTATCCAGG + Intronic
942625335 2:177894372-177894394 GATTAATATTTTTTTTCACCTGG + Intronic
942779468 2:179624168-179624190 CACCTTTATTTATTTTCTCTAGG + Intronic
942835429 2:180290631-180290653 GTTTTATTCTTATTTTCTCCTGG + Intergenic
943304632 2:186244752-186244774 GTTCTATATTGATTTTCACATGG - Intergenic
943781294 2:191827251-191827273 TATATATATATATTTTTTCCTGG + Intergenic
943996568 2:194774251-194774273 GTTCTATATCTATTTTCTCAAGG + Intergenic
944888334 2:204088629-204088651 GATCCAACTTTATTTTTTCCAGG + Intergenic
945423334 2:209666264-209666286 GTAAGATATTTATTTTCTCCAGG + Intronic
945757779 2:213870639-213870661 GCTTTATATATATTTTCTCGTGG - Intronic
945789319 2:214285019-214285041 GATCTATTTTTATTTTTTTGAGG + Intronic
945923148 2:215776968-215776990 GATCTTTATTTCAGTTCTCCAGG + Intergenic
947963889 2:234262506-234262528 GATCCAGTTTTATTTTCTTCTGG + Intergenic
1169032013 20:2416933-2416955 GTGCTATATTTTTTTTCTCTAGG - Intronic
1170238740 20:14138204-14138226 GTTCTATTTTTAATTTCTCAAGG - Intronic
1172405923 20:34689106-34689128 GATTTACATTTATTTCTTCCAGG + Intergenic
1172891194 20:38266574-38266596 GATCTATATTTAGTTTTTTGAGG - Intronic
1173603481 20:44312372-44312394 TTTCTAAATTTATTTTCACCTGG + Intergenic
1174584211 20:51594928-51594950 GATGAATATTTATTTGCTCTTGG - Intergenic
1174589499 20:51634029-51634051 GATCTATTTTTGTTTTAACCTGG - Intronic
1174684354 20:52439204-52439226 GTTCTATTTTTTTTTTCTCCTGG + Intergenic
1176303639 21:5112095-5112117 CATTTCTAGTTATTTTCTCCAGG - Intergenic
1177917249 21:27104422-27104444 GATATATATTTATTTGTTCTTGG + Intergenic
1179853392 21:44149855-44149877 CATTTCTAGTTATTTTCTCCAGG + Intergenic
1181928208 22:26377400-26377422 GAGCTTAATTTGTTTTCTCCTGG - Intronic
1182305826 22:29367394-29367416 GATCTAAAGTTTGTTTCTCCAGG - Intronic
1182313094 22:29423315-29423337 GATCTAAAGTTTGTTTCTCCAGG - Intergenic
1182951863 22:34383577-34383599 CATATATATTTACTTTGTCCTGG - Intergenic
1184270309 22:43377400-43377422 GCTCTATATTTCTTTTTGCCAGG + Intergenic
949240295 3:1863703-1863725 GAAATATTTCTATTTTCTCCTGG - Intergenic
949681039 3:6514721-6514743 GAAGAATATTTCTTTTCTCCTGG - Intergenic
949742176 3:7248966-7248988 GATCTATATTTATTTTCTCCTGG - Intronic
951267531 3:20586862-20586884 GATCATTATTTATTTTATTCTGG - Intergenic
953203696 3:40800870-40800892 CCTGGATATTTATTTTCTCCTGG - Intergenic
953228350 3:41041711-41041733 GAGATATTTTTACTTTCTCCTGG - Intergenic
954521118 3:51227475-51227497 GAGTTATATTTATATTCTCAAGG - Intronic
955046099 3:55361214-55361236 TATCTACATTTATTTTTTTCTGG - Intergenic
957319867 3:78616411-78616433 AATATATATTTATTTTGGCCAGG - Intronic
957321483 3:78636712-78636734 GCTATATAATTATTTTCTCATGG + Intronic
957949927 3:87111461-87111483 TCTCTATATTTATTATTTCCTGG + Intergenic
958735362 3:98003078-98003100 GATGTATATTTTATTACTCCTGG - Intronic
958760592 3:98302981-98303003 GTTCTATTTTTATTTTCTTGAGG - Intergenic
958995221 3:100896331-100896353 TCTCTATATTCATTATCTCCGGG + Intronic
959842147 3:110989882-110989904 GCTCTATTTTTATTTTCCTCTGG - Intergenic
961924334 3:130461273-130461295 GATCAATATTTATTCTATGCAGG + Intronic
962501520 3:135998786-135998808 GATCTATGTCTATTTTGACCTGG + Intronic
963587947 3:147217218-147217240 GAGCTTTACTTATTTTCCCCAGG + Intergenic
965102315 3:164313675-164313697 GATCTATTTTTAGTTTCTTAAGG - Intergenic
965236411 3:166129795-166129817 TATATATATTTTTTTTTTCCTGG + Intergenic
965414173 3:168371755-168371777 GTTTTGTATTTCTTTTCTCCTGG + Intergenic
966274237 3:178145559-178145581 TATCAATATTTAATTTCTACTGG - Intergenic
967820538 3:193835225-193835247 CATCTATATTTTTTGGCTCCTGG - Intergenic
970137819 4:12945257-12945279 TATTTTTATTTATTTTCTCCTGG - Intergenic
970324353 4:14907884-14907906 TATTTATATTTTTTCTCTCCTGG + Intergenic
970809166 4:20071356-20071378 AATATAAATTTATTTTCTCATGG - Intergenic
971517662 4:27508979-27509001 AACATATATTTATTTTCTCGAGG + Intergenic
971633933 4:29032273-29032295 GTTTTTTATTTATTTTCTCAAGG - Intergenic
972186914 4:36540639-36540661 GGTCTACATTTTTTTTATCCTGG + Intergenic
972614673 4:40686660-40686682 GCTCCATTTTTATTTTCTCATGG + Intergenic
972901552 4:43691275-43691297 GCTCTATTTTTGTTTTCTTCAGG + Intergenic
975168497 4:71205548-71205570 TATATATATTTATTTTTTTCTGG + Intronic
977040814 4:92015556-92015578 GATCCATATTTATTCTACCCAGG + Intergenic
977342344 4:95774827-95774849 GATATATATTTCCTTTCTCTTGG - Intergenic
977462846 4:97346950-97346972 CAAATATATTTAGTTTCTCCAGG + Intronic
978160739 4:105545039-105545061 AATCTATATTTTTTCTTTCCAGG + Intergenic
979747182 4:124231466-124231488 AATCAATATGTATTTTCTCCTGG - Intergenic
980750820 4:137085636-137085658 GATCTATAGGTATCTTCTTCTGG + Intergenic
980754462 4:137139392-137139414 GTTCTTTATTTGTTTTGTCCTGG - Intergenic
981617961 4:146662496-146662518 GATCTTTATTTATTGTCTGGGGG + Intergenic
981640470 4:146937241-146937263 GATTTATATATCTTTTCTCCTGG - Intronic
981909802 4:149965885-149965907 TTTCTTTATTTTTTTTCTCCAGG + Intergenic
982120247 4:152136353-152136375 GAACATTATTTGTTTTCTCCAGG - Intergenic
982421069 4:155198606-155198628 GATATATATTTTTTTTCTGTTGG + Intergenic
982631810 4:157839519-157839541 GAGCTGTATTTCTTTTCTTCTGG - Intergenic
983070622 4:163264034-163264056 AATCAGCATTTATTTTCTCCAGG - Intergenic
983099966 4:163613133-163613155 GATCTTTATTTATCTACTTCTGG - Intronic
983304601 4:165970468-165970490 ACTCAATATTTATTTTCTCCTGG + Intronic
983408594 4:167366233-167366255 GATCTATATTTTTTTTCAGAGGG - Intergenic
984204693 4:176772501-176772523 TTTCTAGATTTGTTTTCTCCAGG - Intronic
984275963 4:177609739-177609761 TATCTATAATTATTTTCTATTGG + Intergenic
984613016 4:181862514-181862536 GAGATATATTTTTTTTCTGCAGG - Intergenic
985022644 4:185708609-185708631 GAGCTATTTTTAGTTTTTCCTGG + Intronic
986137623 5:4997389-4997411 GTTCTATTTTTATTTTATCCAGG + Intergenic
986487712 5:8256250-8256272 GATCTACATTTAGTTCCTCAAGG + Intergenic
986536700 5:8795250-8795272 GTTCTATATTTAATTTCTTTAGG + Intergenic
986878503 5:12140315-12140337 GCTCTAAATTTATTTTCTGGCGG + Intergenic
986957268 5:13168326-13168348 GTTCTATTTTTATTTTTTACAGG + Intergenic
987305088 5:16629974-16629996 GAAGTATTTTTATTTTCTCAGGG + Intergenic
987318780 5:16748660-16748682 GATTTATATTTATGTAATCCAGG - Intronic
987516119 5:18911680-18911702 GCTCTATTTTTATTTTCTTGAGG + Intergenic
988502819 5:31797890-31797912 GGTTTATATTGATTTTCTCTGGG + Intronic
988924726 5:35978382-35978404 GATCTATTTTTCTTTTCTTTTGG - Intronic
989725860 5:44585579-44585601 AATCTATTTTTATCTTCTCTCGG + Intergenic
992010460 5:72520948-72520970 GTTTTCTATTTATTTTCTCATGG + Intergenic
993766828 5:91869963-91869985 GATCTAAATTCATTTTCTCATGG - Intergenic
994827393 5:104732036-104732058 GATTTATATTAAGTTACTCCAGG + Intergenic
995767513 5:115635230-115635252 CATCTCTATTTTTTTTATCCTGG - Intergenic
995968695 5:117940865-117940887 AATCTATAATTATTTTTCCCTGG - Intergenic
996184482 5:120459230-120459252 GATCTATAAAAATTTTCTCCTGG + Intergenic
996311116 5:122107104-122107126 TATCTGTATTTATTTATTCCAGG + Intergenic
996372965 5:122772754-122772776 CATAAATATTTATTTTCTCATGG - Intergenic
996435349 5:123428078-123428100 GGCCTATATTTATATTCTACTGG + Intergenic
997017650 5:129955358-129955380 GATCTGCATTTATTCTTTCCTGG + Intronic
997414740 5:133717316-133717338 GAACAACATTTGTTTTCTCCAGG + Intergenic
997820516 5:137061865-137061887 GAGTTAAATTTAATTTCTCCTGG - Intronic
998244339 5:140484310-140484332 GAACTAAAGTTATTTTTTCCAGG + Intronic
998913397 5:146986592-146986614 CATCCATATTTTTTTACTCCAGG - Intronic
999033104 5:148316539-148316561 CATTGAAATTTATTTTCTCCAGG + Intergenic
999146301 5:149397910-149397932 CTTCTGTATTTGTTTTCTCCTGG + Intronic
999611703 5:153376714-153376736 GTTCTATCTTTATTGTCTACGGG + Intergenic
1000070671 5:157737866-157737888 TATCTATTTTTATTTTCTCAGGG + Exonic
1000549625 5:162644198-162644220 AAACTGTATTCATTTTCTCCTGG - Intergenic
1000586041 5:163100297-163100319 ATTCTATATTTCTTTGCTCCAGG - Intergenic
1003865581 6:10359571-10359593 TATCTATATCTATTTTCTATTGG - Intergenic
1004634045 6:17449721-17449743 GTTATATAATTATTTTCTCAAGG + Intronic
1004677205 6:17854926-17854948 GATCTATATTTTTTTTAACTAGG - Intronic
1004926847 6:20424146-20424168 ATTCTATATATTTTTTCTCCTGG + Intronic
1005275282 6:24210477-24210499 GAATTATCTTTATTTCCTCCTGG + Intronic
1005391278 6:25336093-25336115 TATTTTTATTTTTTTTCTCCTGG - Intronic
1006247291 6:32748755-32748777 CATTTATAATTATTTTCTCCCGG - Intergenic
1007973634 6:46078030-46078052 GATGTATTTTTTTTTTCTCATGG - Intronic
1008054663 6:46933962-46933984 CATCTATTTTTAGTTTCTTCCGG + Intronic
1008803032 6:55393214-55393236 TACCTAAATTTACTTTCTCCAGG - Intronic
1009586749 6:65617193-65617215 AAACAATATTTTTTTTCTCCAGG - Intronic
1009935317 6:70227156-70227178 GATCCATTTGTATTTTATCCTGG - Intronic
1010079980 6:71849716-71849738 CATTTATCTTTAGTTTCTCCAGG - Intergenic
1010364891 6:75039469-75039491 GATCTATATTTGTTGTCTACTGG - Intergenic
1010640452 6:78319912-78319934 CATCTCAGTTTATTTTCTCCTGG + Intergenic
1010786605 6:80009317-80009339 GTCATATAATTATTTTCTCCAGG - Intronic
1011095261 6:83654837-83654859 GAGCTACATTGATTTTCTTCTGG - Intronic
1011097243 6:83679801-83679823 GATTAATATTTAAGTTCTCCAGG - Intronic
1011233093 6:85185955-85185977 TATATATATTTTTTTTCTCTTGG - Intergenic
1012007279 6:93729178-93729200 GAGCTATAGTTATTATCTCAAGG - Intergenic
1012158818 6:95856897-95856919 GCTTTCTATTTATTTTCCCCAGG + Intergenic
1012311090 6:97724760-97724782 GAAATTTATTTATTTTCTCACGG - Intergenic
1012538366 6:100327607-100327629 GTTCTTGATTTATTTTCTCTGGG - Intergenic
1012612869 6:101237115-101237137 GATCTATTTTTAATAACTCCTGG - Intergenic
1012648677 6:101723217-101723239 GATTTATCTTTTTTTTCTCCAGG + Intronic
1013691146 6:112645881-112645903 GATCTCTATATATGTTCTCATGG - Intergenic
1013711050 6:112899594-112899616 GATCTATTTTTAATTTCTTTAGG + Intergenic
1014996008 6:128145538-128145560 TATATATATTTATTTTTTCATGG - Intronic
1015035399 6:128647326-128647348 ATTCAATATTTACTTTCTCCAGG + Intergenic
1015041443 6:128725138-128725160 ACTGTATATTTTTTTTCTCCAGG + Intergenic
1015868559 6:137752575-137752597 GCTCAAAATCTATTTTCTCCTGG - Intergenic
1015902712 6:138084042-138084064 GAAGGATATTTCTTTTCTCCTGG - Intergenic
1017612449 6:156203676-156203698 GATCTTTATTATTTTTTTCCTGG - Intergenic
1017689878 6:156953435-156953457 AAACTATTTTTATTTTCTCCTGG + Intronic
1020353407 7:7250148-7250170 TATCAATATTGCTTTTCTCCAGG + Intergenic
1020842571 7:13238095-13238117 GATATGTCTTTATTTTCTTCTGG - Intergenic
1021093590 7:16510475-16510497 CATCTATGGTTAGTTTCTCCTGG + Intronic
1021770297 7:23993721-23993743 GCTCTATTTTTATTTTTTTCAGG + Intergenic
1021852108 7:24818344-24818366 CATCTATCTTTTTTTTCTCTTGG - Intronic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1023479474 7:40617543-40617565 TAGCTAAATTTCTTTTCTCCTGG - Intronic
1023490675 7:40737284-40737306 GTTTTATATTGATTTTCTCTTGG - Intronic
1023742126 7:43290245-43290267 AAAATATTTTTATTTTCTCCAGG + Intronic
1023887014 7:44365726-44365748 GATTTACAAATATTTTCTCCTGG - Intergenic
1024693625 7:51831655-51831677 AATATAAATTTATTTTCTCAAGG + Intergenic
1026150272 7:67782471-67782493 TATCTCTCCTTATTTTCTCCAGG + Intergenic
1029890351 7:103922533-103922555 AATCCATATTTATAGTCTCCTGG - Intronic
1032136274 7:129281432-129281454 GATCTTTATTTTCTTTCTTCTGG + Intronic
1032742422 7:134752095-134752117 GATCCATATTAACTTTCTCCTGG - Intronic
1033232023 7:139606690-139606712 TATCTGTAGTTATTTTCTCTTGG - Intronic
1033550471 7:142442420-142442442 AATCTGTATTTTTTTTCTTCTGG + Intergenic
1033947191 7:146734919-146734941 AATCTATTTTTATTTTCTGAAGG + Intronic
1034487981 7:151378030-151378052 GATTTAGATATATTTTCTCCAGG + Exonic
1035320890 7:158028634-158028656 GTTAAATATTTACTTTCTCCAGG - Intronic
1037288844 8:17329594-17329616 GAAGAATATTTATGTTCTCCAGG + Intronic
1037634716 8:20691476-20691498 GTTCTATGTTCATTTTTTCCAGG + Intergenic
1038667881 8:29556866-29556888 GTTCTATATTTCTATTTTCCTGG - Intergenic
1038745255 8:30249195-30249217 GATCTTTTTTTTTTTTTTCCAGG - Intergenic
1039416480 8:37398889-37398911 GATTTAAATATATTTTCTCAAGG - Intergenic
1040000679 8:42573797-42573819 TATCTGTATTATTTTTCTCCTGG - Intergenic
1041861439 8:62517876-62517898 GATATAGATATAGTTTCTCCAGG - Intronic
1042844992 8:73160792-73160814 TAACCATATTTATTTTCTCTTGG - Intergenic
1043046695 8:75333162-75333184 GATATATATATATATTCTCTAGG - Intergenic
1043102846 8:76067977-76067999 GTTCTATTTTTAATTTCTTCAGG - Intergenic
1043444761 8:80308372-80308394 GATCTCTTTTTTTCTTCTCCGGG + Intergenic
1043995550 8:86810949-86810971 TATCTTTATTTTTTTTCCCCTGG + Intergenic
1045707695 8:104945533-104945555 GATCTAGAATTATTGTTTCCTGG + Intronic
1045950785 8:107849439-107849461 GATTTATGTTTATTTTCATCTGG - Intergenic
1047335050 8:123927736-123927758 GATCTATTTTTATTTAGTCAGGG - Intronic
1048430146 8:134362605-134362627 TTTCTATATTTATTTCATCCAGG + Intergenic
1050083255 9:1937915-1937937 GAACTATATATCATTTCTCCTGG + Intergenic
1050503476 9:6323053-6323075 CATATATATTTTTTCTCTCCTGG - Intergenic
1050979510 9:11991973-11991995 GCTCTATTTTTAGTTTTTCCAGG - Intergenic
1051477479 9:17523563-17523585 TATCTATATTTATTTTCACTAGG - Intergenic
1051949310 9:22611814-22611836 CTTCTTTATTTGTTTTCTCCAGG - Intergenic
1053027508 9:34742100-34742122 GTTCTATTTTTATATTCTCTTGG - Intergenic
1053340806 9:37327777-37327799 GATCAATATTTTTATTTTCCAGG + Exonic
1053596625 9:39568712-39568734 GGTCTTTATTTTTTTCCTCCAGG + Intergenic
1054569631 9:66796290-66796312 GGTCTTTATTTTTTTCCTCCAGG - Intergenic
1054951129 9:70852951-70852973 GATATATATATATTTTTTTCTGG + Intronic
1055041483 9:71878393-71878415 GTCTTATCTTTATTTTCTCCTGG - Intronic
1055732443 9:79292238-79292260 GATCTAGCTATATTTTCTGCTGG - Intergenic
1056407389 9:86287670-86287692 GATCTTTTTTTTTTTTCCCCAGG + Intergenic
1056674416 9:88662219-88662241 GATCTATATTTTTCTTCTCAGGG - Intergenic
1058672134 9:107368574-107368596 TATTTATATTTATTTTTCCCTGG + Intergenic
1061605494 9:131707129-131707151 GATCAATGCTGATTTTCTCCTGG + Intronic
1186553867 X:10536293-10536315 AATCTATTTTTTTTTTCCCCAGG - Intronic
1186744284 X:12550454-12550476 GATATCTATTTATTTTTCCCAGG + Intronic
1188627346 X:32301614-32301636 AGTTTGTATTTATTTTCTCCTGG - Intronic
1188878730 X:35465579-35465601 GTTTTATTTTTATTTTGTCCAGG - Intergenic
1190100116 X:47516289-47516311 GATCTATTTTTATTTTTTTGAGG + Intergenic
1190373992 X:49771017-49771039 GCTCTATTTTTAGTTTTTCCAGG + Intergenic
1192170299 X:68850619-68850641 GCTTTATATTTATTATCTCGTGG - Intergenic
1192370689 X:70510414-70510436 GATCTCTATTTACTGCCTCCTGG - Intergenic
1192389432 X:70710417-70710439 GATGTAAATTTATTTGATCCAGG - Intronic
1192616031 X:72623601-72623623 GATTTATCTTCATTCTCTCCAGG - Intronic
1192683267 X:73276578-73276600 GAAATTTATTTATTTTCTCTTGG + Intergenic
1193189064 X:78548169-78548191 TCTCTATATTTATTTTCCCTGGG + Intergenic
1193589481 X:83370301-83370323 GGTCTATTTTTACTTTCTTCAGG + Intergenic
1193881495 X:86927836-86927858 GATTTATATAGAGTTTCTCCTGG + Intergenic
1194068171 X:89287422-89287444 GATCGATTTTTATCTTCTCATGG - Intergenic
1194179236 X:90692459-90692481 GGTCTATTTTTAGTTTCTCTCGG + Intergenic
1194374539 X:93115364-93115386 GATCTCTTTTTATTTTCTGTTGG + Intergenic
1194426117 X:93740386-93740408 CATCTATATTTGTATGCTCCAGG - Intergenic
1194897398 X:99461248-99461270 GTTCAATTTTTTTTTTCTCCTGG + Intergenic
1195361729 X:104088834-104088856 TATTTATATTTATATTCTCTTGG + Intergenic
1195391955 X:104371646-104371668 TATCTATAGATATTTTCTCATGG + Intergenic
1196999957 X:121428261-121428283 TCTCTACATTTATTTTTTCCTGG + Intergenic
1197616206 X:128694650-128694672 TTCCTATATTTATTTTCCCCTGG - Intergenic
1200298848 X:154951882-154951904 GATATATATTTTTTTTCCTCTGG - Intronic
1200682562 Y:6229418-6229440 GATCTCTTTTTATTTTCTGTTGG + Intergenic
1200722313 Y:6621592-6621614 GATCGATTTTTATCTTCTCATGG - Intergenic
1201695654 Y:16822103-16822125 GTACAATACTTATTTTCTCCAGG - Intergenic
1201987060 Y:19980106-19980128 TAGCCAAATTTATTTTCTCCTGG - Intergenic