ID: 949743557

View in Genome Browser
Species Human (GRCh38)
Location 3:7263711-7263733
Sequence TCGTGCTGGTAGCAGTGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949743557 Original CRISPR TCGTGCTGGTAGCAGTGTGA CGG Intronic
901917996 1:12514880-12514902 CAGTGCTGGTAGGAATGTGAAGG + Intergenic
902988721 1:20171367-20171389 ACGTGCTGGTGGCAGTGGGCAGG + Intronic
904551609 1:31324046-31324068 TCAGTCAGGTAGCAGTGTGATGG - Intronic
905284934 1:36873135-36873157 ACGTGCTGGTGGCAGGATGAGGG - Intronic
908534511 1:65066180-65066202 GCGTGCGGGTAGCAGAGTGAGGG + Intergenic
908794641 1:67819042-67819064 TCATGCTGGTGGCAGTGTGCAGG + Intronic
909997747 1:82301425-82301447 TCATTCTGGTTGCAGGGTGAAGG + Intergenic
910825022 1:91397744-91397766 TCGTCCTGGTAGCCGTGAGTAGG - Intronic
913179490 1:116307710-116307732 TCACTCAGGTAGCAGTGTGAAGG - Intergenic
919656846 1:200205351-200205373 TCATGCTGGCAGCAGTATGGAGG + Intergenic
920326490 1:205169025-205169047 TCCTGCTGGTAACAGTGGGGTGG + Intronic
922551325 1:226496811-226496833 TCGTGGTGGGAGCAGAGTGCCGG - Intergenic
924195286 1:241600999-241601021 TCGTGCTGTTAGCCTTGTGAGGG + Intronic
1064701211 10:18023657-18023679 TTATGCTGGTTGCAGTGTGCTGG + Intronic
1066502410 10:36006969-36006991 TCATCCTGGCAGCAGTGTGGAGG + Intergenic
1067709649 10:48637717-48637739 TGGTGCTGGGATCAGTGAGACGG + Intronic
1070829295 10:79408824-79408846 GCTTGCTGGTGGCAGTGTGTAGG - Intronic
1071958791 10:90787549-90787571 ACGTGCTGGTAGCTGTGGGTGGG + Intronic
1073574741 10:104612938-104612960 TTGTGCTGTTTGCAGTGGGAAGG + Intergenic
1073794301 10:106971098-106971120 TCGTGGTGGCAACAGTGTAAAGG - Intronic
1075225431 10:120624699-120624721 TCTTGCTGGGAGCTGTGAGAGGG + Intergenic
1075360784 10:121831414-121831436 TCTTGCTTGTAGCTGTGTTATGG - Intronic
1084321545 11:68376125-68376147 GCGTCCTGGGAGCTGTGTGAGGG + Intronic
1085838568 11:79983260-79983282 TCCTGCTGGTGGCACTGTGGTGG - Intergenic
1086036437 11:82420793-82420815 TCTAGCTGGTAGAAGTGGGATGG - Intergenic
1086218239 11:84408937-84408959 TCGTTCTGTCAGCAGTGTGGAGG - Intronic
1086426547 11:86689364-86689386 TTGTGCTGGGATCAGTGTGGAGG + Intergenic
1088533116 11:110832006-110832028 CCCTGCTGGTTGCAGTGTGTGGG - Intergenic
1090679581 11:129039558-129039580 TAGGGCTGGGAGCAGTATGAGGG + Intronic
1091644498 12:2263532-2263554 CGGTGTTGGTAGAAGTGTGACGG + Intronic
1094507004 12:31070974-31070996 TTAAGCTGGAAGCAGTGTGAAGG - Intergenic
1096629485 12:52916696-52916718 TCGTGCTGTTACCAGAGTGAAGG - Intronic
1098596603 12:72279653-72279675 TGGTGGTGGTGGCAGTGTGAGGG + Intronic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1099823339 12:87743382-87743404 TGGAGCTGGTAGCTGAGTGAAGG - Intergenic
1100420650 12:94429694-94429716 TAGTCCTGGTAGCACAGTGATGG - Intronic
1101568068 12:105928256-105928278 TCATTCTGGTAGCACTGTGGAGG + Intergenic
1101937597 12:109070615-109070637 TTGCTCTGGTGGCAGTGTGAGGG + Intronic
1102453864 12:113059285-113059307 TGGTGCTGGAAGTGGTGTGATGG + Intronic
1106512095 13:30421382-30421404 TCGTGCTGGTGGCAGGTGGATGG - Intergenic
1107995907 13:45860853-45860875 TCTTGCTGGTAGAAGCTTGAGGG - Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1118646532 14:67846285-67846307 TCGTGCTGGTGGCAGTGTGGGGG + Intronic
1119330552 14:73790111-73790133 TCGCCCTGGCAGCAGTGTGGAGG - Intronic
1120092420 14:80348235-80348257 TCTTTCTGGTAGCAGTGAAAGGG - Intronic
1121239089 14:92415076-92415098 TCGTGCTGGCAGGTGTTTGATGG + Intronic
1123411313 15:20062420-20062442 TCGTGCTGGTAAAAGAGTGATGG - Intergenic
1123520661 15:21069539-21069561 TCGTGCTGGTAAAAGAGTGATGG - Intergenic
1126502573 15:49362306-49362328 ACGTGGTGGTAGGAGAGTGAAGG - Intronic
1132888420 16:2192776-2192798 TGGTGCTGGTAGTTGAGTGATGG - Intronic
1134589977 16:15444578-15444600 TATTGATGGTAGCAGTGTGAAGG + Intronic
1136459812 16:30402807-30402829 TCGTGCTGGTCTCACTGAGAAGG - Intergenic
1136557741 16:31018069-31018091 TCCTGCTGGTGGCCGTGTGCGGG + Intergenic
1139492871 16:67296063-67296085 AAGTGCTGGAAGCTGTGTGAGGG + Intronic
1141415065 16:83864253-83864275 ACGTGCTGGTAGTGGGGTGAAGG + Intergenic
1142128949 16:88423707-88423729 TCCTGCCTGTAGCTGTGTGAGGG - Intergenic
1143014855 17:3886263-3886285 TCTTCCTGGAAGCAGTGAGAGGG - Intronic
1143984115 17:10896372-10896394 TAGTGCTGGTAGGGGAGTGAAGG + Intergenic
1146492828 17:33294245-33294267 TGGTGGTGGAGGCAGTGTGAAGG + Intronic
1146522367 17:33535863-33535885 TCGTGCAATTAGCAGTGTGTGGG - Intronic
1147027583 17:37601702-37601724 TCGTCCAGGTTGGAGTGTGATGG + Intronic
1148084768 17:44987486-44987508 TGGCGCTGGTAGCAGTGGGGCGG + Intergenic
1149785582 17:59432018-59432040 ACGTTCTGGAAGCAGTCTGAAGG + Intergenic
1149935264 17:60798868-60798890 TCGTTCTGGTAGCTGTGCAATGG + Intronic
1150291521 17:63985079-63985101 TTGTGCTGGGAGCTGTGTGTGGG + Intergenic
1151060283 17:71084352-71084374 TCCTACTGGGAGCAGTGGGAAGG + Intergenic
1152199632 17:78937845-78937867 TCGTGCTAGTACCTGTCTGAAGG + Intergenic
1152976130 18:220511-220533 TGCTGCTGGTAGGAGTCTGATGG - Intronic
1155395003 18:25377674-25377696 TCTTGCTTGTAGCAGTGTGTGGG + Intergenic
1155596364 18:27492720-27492742 TGATTTTGGTAGCAGTGTGAAGG + Intergenic
1159038429 18:63299485-63299507 TACTGCTGGTAGCAGTGTGTTGG - Intronic
1166534250 19:43562267-43562289 TCCTGTTGATAGCAGTGTGCAGG - Intronic
925105528 2:1287586-1287608 CCGTGCAGGTGGCAGAGTGACGG + Intronic
927032478 2:19136732-19136754 TTGTGCTGGTAGCCATGTGCAGG + Intergenic
928416496 2:31096797-31096819 TGGTGCTGGTGGTAGTGTGTTGG - Intronic
933117953 2:78498064-78498086 TCATGCTGGCAGCAGTGGCATGG - Intergenic
942837826 2:180321341-180321363 TTGTGCTGGTAACCCTGTGATGG - Intergenic
943137793 2:183937544-183937566 AGGTGCTGGTAGCAGTGGGCAGG - Intergenic
945881868 2:215333160-215333182 TGGTTGTGGGAGCAGTGTGAGGG - Intronic
946328673 2:218997781-218997803 TGGTGATGGTGGCAGGGTGAGGG - Intergenic
947063622 2:226195035-226195057 TTATTCTGGTTGCAGTGTGAAGG - Intergenic
1168734328 20:116787-116809 ACCTGCTGGTAGAAGTGTGTAGG + Intergenic
1169411429 20:5373814-5373836 CCCTTCTGGCAGCAGTGTGAGGG + Intergenic
1170779078 20:19407419-19407441 TCCTGCTGCTTCCAGTGTGAAGG + Intronic
1176658855 21:9614582-9614604 TCCTGCTGCTAGCAGGCTGAGGG - Intergenic
1177194554 21:17889437-17889459 TAGTGCTGGTTCCAGTCTGAAGG - Intergenic
1179479319 21:41667642-41667664 TCATGGTGGTAAAAGTGTGATGG - Intergenic
1182259399 22:29062456-29062478 TAGAGCTGTTAGCAGTGTCAAGG + Intergenic
1182436169 22:30331534-30331556 ACATGCTGGGAGCAGTGTCAGGG + Intergenic
1182656681 22:31895919-31895941 TCATGCTGGTATCAGTGAGCTGG - Intronic
1184438158 22:44492832-44492854 CCTTGCTGGTGGCAGTGTAAGGG + Exonic
949743557 3:7263711-7263733 TCGTGCTGGTAGCAGTGTGACGG + Intronic
950258918 3:11529753-11529775 TCATCGTGGTAGCAGTGGGAGGG + Intronic
951258846 3:20482512-20482534 TCATGCTGGCAGCAGTGGCAGGG - Intergenic
954497808 3:50982422-50982444 TCGTGCTGGCTGCAGTGGGGAGG + Intronic
955525325 3:59813895-59813917 TGGTGATGGTAGCAGGGTGTGGG + Intronic
956240407 3:67123768-67123790 TGGGGCTGGAAGCTGTGTGATGG - Intergenic
956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG + Intergenic
957579419 3:82051695-82051717 TCGTGCCAGTAGGAGGGTGAAGG + Intergenic
959439411 3:106358354-106358376 TCATGCTGGCAGCAGTGACATGG + Intergenic
959550447 3:107650094-107650116 TGGTGCTGTTCCCAGTGTGAAGG + Intronic
961009717 3:123427476-123427498 TCCTGCTGTTACCTGTGTGAGGG + Intronic
962631791 3:137283787-137283809 TAGTGCTGGTATATGTGTGAGGG + Intergenic
969469411 4:7378692-7378714 GTGTTCTGGTAGCAGTGTGGGGG - Intronic
974284869 4:59851406-59851428 TGGTTCTGGTTGCAGTGTGAAGG + Intergenic
974585824 4:63875673-63875695 TGGTGCTGGTGGGAGTGTGGCGG - Intergenic
993775701 5:91992916-91992938 TCATGTTGGTAGCAGTGTGGAGG + Intergenic
993795973 5:92268193-92268215 TCATGCTGGCAGCAGTGGCAGGG - Intergenic
995458879 5:112381697-112381719 TCCTGCTGTTGGCAGTGTCAAGG - Intronic
997175560 5:131772757-131772779 TCATGATGGTAGCAGAGAGATGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997592969 5:135086846-135086868 TCCTGGTGGGAGCAGTGTCAGGG + Intronic
998370170 5:141655754-141655776 TCGTGCTGGTGGGAGCGTGAGGG + Exonic
999085735 5:148887684-148887706 TCATTCTGGTAGATGTGTGATGG - Intergenic
1002441536 5:179266937-179266959 TCGTACTGGTTGCAGTGTGAGGG - Intronic
1006902677 6:37513179-37513201 GGGTGCTGGTAGCACCGTGATGG - Intergenic
1007068788 6:39019530-39019552 TGGTGATGGTGGCTGTGTGATGG + Intronic
1007758410 6:44116329-44116351 TGTTGCTGTTAGAAGTGTGATGG - Intronic
1011337354 6:86275904-86275926 TCATGCTGGCAGCAGTGGCAGGG + Intergenic
1017630615 6:156392942-156392964 TTGCCCTGGCAGCAGTGTGAAGG - Intergenic
1019520647 7:1459277-1459299 TGGTGCCGGCAGCAGTGCGAGGG - Exonic
1019738270 7:2660937-2660959 TCGTCCAGGCAGGAGTGTGAAGG - Intronic
1021514865 7:21473093-21473115 TTTTTCTGGCAGCAGTGTGAAGG + Intronic
1024021208 7:45372720-45372742 TTGTGGTGGGGGCAGTGTGAGGG - Intergenic
1026177078 7:68007292-68007314 TCTTGGTGGTAGGAGTGGGAGGG + Intergenic
1028829593 7:95312875-95312897 TTGTGCTGGGAGCAGAGTGAAGG + Intronic
1034854438 7:154528859-154528881 AGGTGCAGGGAGCAGTGTGAGGG + Intronic
1037689573 8:21170791-21170813 CAGTGGTGGTAGCAGTGAGAAGG + Intergenic
1044402064 8:91784078-91784100 TAGTCCTGGAAGCAATGTGAAGG + Intergenic
1051110254 9:13627435-13627457 TCATGCTGGTAGCAGTGACATGG - Intergenic
1051225629 9:14896174-14896196 TGGTGCTGGTGGGAGTGGGAGGG - Intronic
1057979923 9:99650413-99650435 TCATGCTGGCAGCAGTGGCATGG - Intergenic
1059495059 9:114702602-114702624 TCGGGCTGGAAGCTGTGAGATGG + Intergenic
1059509020 9:114826710-114826732 TCATTCTGGCAGCTGTGTGAAGG + Intergenic
1060857497 9:126926681-126926703 TAGTCCTGGTGGCAGTGTGGAGG + Intronic
1061782287 9:133003339-133003361 TCGTGCTGGGCGCAGGGGGAGGG - Intergenic
1062098593 9:134716066-134716088 TCATGATGCTAGCAGTGTGGTGG + Intronic
1062447007 9:136599340-136599362 TCCTGCTGGCATCAGCGTGAAGG - Intergenic
1203636601 Un_KI270750v1:118189-118211 TCCTGCTGCTAGCAGGCTGAGGG - Intergenic
1186760204 X:12715054-12715076 TTGTGCTGGGGGCAGTTTGAGGG + Intronic
1190577900 X:51859959-51859981 TCCTGTGGGTAGGAGTGTGATGG + Intronic
1191105337 X:56768822-56768844 TCGCACTGGGGGCAGTGTGAGGG + Intergenic
1191106330 X:56774224-56774246 TCGCACTGGGGGCAGTGTGAGGG + Intergenic
1191107323 X:56779626-56779648 TCGCACTGGGGGCAGTGTGAGGG + Intergenic
1192529643 X:71873333-71873355 TCGTCCTGGTAGCGGTGGGAGGG + Intergenic
1194323524 X:92481255-92481277 TCATGCTGGCAGCAGTGGAAGGG + Intronic
1196192730 X:112811418-112811440 TGGTGATGGTAGGAGGGTGATGG + Intronic
1196554452 X:117070472-117070494 TCTCGCTGGTAGCAGTGGCATGG - Intergenic
1200305574 X:155023060-155023082 TCATACTGGCAGCAGTGTGAGGG - Intronic
1200631626 Y:5594421-5594443 TCATGCTGGCAGCAGTGGAAGGG + Intronic
1201619203 Y:15936682-15936704 TCTTGATGGTAGCTGTGTTAGGG - Intergenic